Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137935177:

Variant ID: vg0137935177 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37935177
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTGAGCAAAATGGCTCCTTCTCGTTAATTGCTACCATCGATAATCTTGATAGGGTGTTTGATATAGTTGGTAGGAAATGTCCAAACTACGTATCTCT[C/G]
TCATCTCTCACTATTCTTTTTCTCAAATTTAGCCATAGTCTTACCAAAACCCATATCTTGTGCTTTCTCTGTCAAAAAATATTGCAACTTAGGATAGAGT

Reverse complement sequence

ACTCTATCCTAAGTTGCAATATTTTTTGACAGAGAAAGCACAAGATATGGGTTTTGGTAAGACTATGGCTAAATTTGAGAAAAAGAATAGTGAGAGATGA[G/C]
AGAGATACGTAGTTTGGACATTTCCTACCAACTATATCAAACACCCTATCAAGATTATCGATGGTAGCAATTAACGAGAAGGAGCCATTTTGCTCAAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.10%	17.60%	0.25%	0.11%	NA
All Indica	2759	69.70%	29.70%	0.40%	0.18%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	63.70%	35.60%	0.50%	0.17%	NA
Indica II	465	86.00%	13.10%	0.00%	0.86%	NA
Indica III	913	58.20%	41.50%	0.33%	0.00%	NA
Indica Intermediate	786	78.10%	21.20%	0.64%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137935177	C -> G	LOC_Os01g65370.1	downstream_gene_variant ; 1882.0bp to feature; MODIFIER	silent_mutation	Average:52.283; most accessible tissue: Minghui63 flower, score: 74.976	N	N	N	N
vg0137935177	C -> G	LOC_Os01g65370-LOC_Os01g65380	intergenic_region ; MODIFIER	silent_mutation	Average:52.283; most accessible tissue: Minghui63 flower, score: 74.976	N	N	N	N
vg0137935177	C -> DEL	N	N	silent_mutation	Average:52.283; most accessible tissue: Minghui63 flower, score: 74.976	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137935177	NA	7.84E-06	mr1375	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137935177	9.01E-10	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137935177	3.83E-14	4.35E-16	mr1517	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137935177	1.61E-09	NA	mr1538	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137935177	3.58E-12	2.48E-13	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137935177	3.32E-06	1.52E-06	mr1134_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137935177	4.25E-09	NA	mr1517_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137935177	2.10E-14	1.17E-14	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137935177	2.01E-08	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137935177	5.61E-12	1.96E-15	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251