Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137911881:

Variant ID: vg0137911881 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 37911881
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGCCTACCGGTCCTCATTTCACCGTTACTACAAAATCGTCGTTGTATCACCATTGTTATAAAAAGGGATCACATAAACCGATGTCTTATACTCCCTCC[G/A]
TACTCGTAAAGAAAGTCATTTTGGACAGTGACATGATCTCCAAAATACAACTTTGACTTCTTGTTTCTATAAAAATATTTATTAAAAAATGATATATGTA

Reverse complement sequence

TACATATATCATTTTTTAATAAATATTTTTATAGAAACAAGAAGTCAAAGTTGTATTTTGGAGATCATGTCACTGTCCAAAATGACTTTCTTTACGAGTA[C/T]
GGAGGGAGTATAAGACATCGGTTTATGTGATCCCTTTTTATAACAATGGTGATACAACGACGATTTTGTAGTAACGGTGAAATGAGGACCGGTAGGCTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 35.30% 0.06% 0.00% NA
All Indica  2759 98.30% 1.70% 0.04% 0.00% NA
All Japonica  1512 2.50% 97.40% 0.07% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.60% 0.13% 0.00% NA
Temperate Japonica  767 2.30% 97.50% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0137911881 G -> A LOC_Os01g65340.1 downstream_gene_variant ; 525.0bp to feature; MODIFIER silent_mutation Average:53.71; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0137911881 G -> A LOC_Os01g65350.1 downstream_gene_variant ; 2876.0bp to feature; MODIFIER silent_mutation Average:53.71; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0137911881 G -> A LOC_Os01g65350.2 downstream_gene_variant ; 2880.0bp to feature; MODIFIER silent_mutation Average:53.71; most accessible tissue: Minghui63 root, score: 73.351 N N N N
vg0137911881 G -> A LOC_Os01g65340-LOC_Os01g65350 intergenic_region ; MODIFIER silent_mutation Average:53.71; most accessible tissue: Minghui63 root, score: 73.351 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0137911881 NA 9.59E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 6.89E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 6.30E-10 1.48E-99 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 9.60E-11 1.69E-15 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.95E-11 3.59E-97 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 4.21E-10 4.78E-14 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 2.95E-44 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 4.87E-29 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 6.68E-09 4.20E-108 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.65E-09 5.97E-15 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.77E-13 9.79E-113 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 7.43E-06 9.93E-08 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 1.40E-10 3.38E-84 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 7.27E-10 8.40E-15 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 1.35E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.83E-06 6.43E-42 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 7.47E-06 7.47E-06 mr1670 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.77E-09 1.60E-100 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 7.59E-06 1.48E-07 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 7.46E-33 mr1737 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 2.67E-89 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 1.79E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 5.51E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.06E-11 6.10E-113 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.80E-16 9.79E-30 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 5.75E-40 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 5.10E-50 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 8.19E-09 1.05E-101 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 4.99E-15 2.02E-27 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.88E-13 1.06E-164 mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.48E-07 1.32E-11 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 1.24E-12 1.73E-126 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 2.58E-11 2.77E-18 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 5.56E-42 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 6.51E-07 6.51E-07 mr1541_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 1.24E-06 1.27E-54 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 4.80E-14 1.07E-140 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137911881 NA 1.22E-11 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251