Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137799856:

Variant ID: vg0137799856 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37799856
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCCGAATTTCAGTTATTTCCTAATTGTATTTCTATATGTACTCTATACTCTACTTCTAATATT[T/C]
CTTATTTTTAATTCCGAATTTCATTTATTTCCTAATTGTATTTCTATATGGACTCTAGAGGAGAGACTCTAGTCTCCTCTTTTAATATTACTTATTTTTT

Reverse complement sequence

AAAAAATAAGTAATATTAAAAGAGGAGACTAGAGTCTCTCCTCTAGAGTCCATATAGAAATACAATTAGGAAATAAATGAAATTCGGAATTAAAAATAAG[A/G]
AATATTAGAAGTAGAGTATAGAGTACATATAGAAATACAATTAGGAAATAACTGAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.90%	17.00%	3.32%	37.71%	NA
All Indica	2759	5.00%	28.80%	5.62%	60.57%	NA
All Japonica	1512	98.10%	0.10%	0.00%	1.79%	NA
Aus	269	76.20%	0.00%	0.74%	23.05%	NA
Indica I	595	0.80%	36.30%	4.03%	58.82%	NA
Indica II	465	1.90%	14.40%	0.86%	82.80%	NA
Indica III	913	4.90%	37.70%	9.97%	47.43%	NA
Indica Intermediate	786	10.10%	21.40%	4.58%	63.99%	NA
Temperate Japonica	767	98.30%	0.10%	0.00%	1.56%	NA
Tropical Japonica	504	97.80%	0.20%	0.00%	1.98%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	68.90%	8.90%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137799856	T -> DEL	N	N	silent_mutation	Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0137799856	T -> C	LOC_Os01g65120.1	upstream_gene_variant ; 1100.0bp to feature; MODIFIER	silent_mutation	Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0137799856	T -> C	LOC_Os01g65130.1	upstream_gene_variant ; 4162.0bp to feature; MODIFIER	silent_mutation	Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0137799856	T -> C	LOC_Os01g65110.1	downstream_gene_variant ; 2110.0bp to feature; MODIFIER	silent_mutation	Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0137799856	T -> C	LOC_Os01g65110-LOC_Os01g65120	intergenic_region ; MODIFIER	silent_mutation	Average:15.368; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137799856	NA	3.57E-06	mr1375	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856	1.10E-09	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856	5.14E-14	1.64E-16	mr1517	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856	6.47E-07	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856	6.49E-09	4.96E-12	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856	1.50E-10	NA	mr1517_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856	5.81E-18	1.19E-16	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856	8.93E-08	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137799856	6.83E-12	3.70E-17	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251