Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0137014902:

Variant ID: vg0137014902 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 37014902
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACCTCTTTTATCTCAGAAATTATAAAATATTGCCTCCGGTGTCTCACAGCCAATTTCACAAACTTTTATAGTGTCCGTGGGCAAAGCCAAGATTTTGCA[G/C]
TGTCTCACAGCCAATTACACGATTTTTGGGTGTCCTGTAGCAAATTTTGCCGTAGTAGTAAAAGTCAGGGCCGTCTCTAGAAATTTAGGGTCCCGGAGTG

Reverse complement sequence

CACTCCGGGACCCTAAATTTCTAGAGACGGCCCTGACTTTTACTACTACGGCAAAATTTGCTACAGGACACCCAAAAATCGTGTAATTGGCTGTGAGACA[C/G]
TGCAAAATCTTGGCTTTGCCCACGGACACTATAAAAGTTTGTGAAATTGGCTGTGAGACACCGGAGGCAATATTTTATAATTTCTGAGATAAAAGAGGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.50%	4.50%	0.00%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	30.50%	69.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0137014902	G -> C	LOC_Os01g63780.1	upstream_gene_variant ; 3546.0bp to feature; MODIFIER	silent_mutation	Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0137014902	G -> C	LOC_Os01g63800.1	upstream_gene_variant ; 2126.0bp to feature; MODIFIER	silent_mutation	Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0137014902	G -> C	LOC_Os01g63780.2	upstream_gene_variant ; 3546.0bp to feature; MODIFIER	silent_mutation	Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0137014902	G -> C	LOC_Os01g63790.1	downstream_gene_variant ; 1366.0bp to feature; MODIFIER	silent_mutation	Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0137014902	G -> C	LOC_Os01g63790-LOC_Os01g63800	intergenic_region ; MODIFIER	silent_mutation	Average:53.629; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0137014902	NA	2.23E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902	NA	1.31E-42	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902	7.71E-10	9.19E-57	mr1550	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902	NA	2.14E-44	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902	NA	2.75E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902	NA	8.22E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902	NA	1.71E-37	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902	4.11E-06	8.24E-54	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0137014902	NA	3.45E-32	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251