Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136576949:

Variant ID: vg0136576949 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 36576949
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTAAACGGGTCCCCAATTCTTCCTGCAGTTTCTGCCAAAATTTTGAGGTGAACTGGCTACCTCGGTCAGATACTATCTTTTTGGGTACTCCATGTAA[A/G]
CACATGATCCTTGCGAGGTACAATTATGCCAATTTCTTTCCCGTATAGGTGGTATGTACTGGTATAAAGTGAGCCACCTTGGTGAGTCGATCCACGACTA

Reverse complement sequence

TAGTCGTGGATCGACTCACCAAGGTGGCTCACTTTATACCAGTACATACCACCTATACGGGAAAGAAATTGGCATAATTGTACCTCGCAAGGATCATGTG[T/C]
TTACATGGAGTACCCAAAAAGATAGTATCTGACCGAGGTAGCCAGTTCACCTCAAAATTTTGGCAGAAACTGCAGGAAGAATTGGGGACCCGTTTAAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	35.70%	9.10%	5.14%	NA
All Indica	2759	78.30%	10.00%	10.76%	0.94%	NA
All Japonica	1512	1.70%	83.40%	1.59%	13.29%	NA
Aus	269	31.60%	35.70%	32.34%	0.37%	NA
Indica I	595	85.90%	4.50%	9.24%	0.34%	NA
Indica II	465	58.30%	19.40%	21.51%	0.86%	NA
Indica III	913	88.60%	5.60%	4.82%	0.99%	NA
Indica Intermediate	786	72.40%	13.70%	12.47%	1.40%	NA
Temperate Japonica	767	0.90%	90.20%	2.74%	6.13%	NA
Tropical Japonica	504	2.60%	73.00%	0.40%	24.01%	NA
Japonica Intermediate	241	2.50%	83.40%	0.41%	13.69%	NA
VI/Aromatic	96	69.80%	17.70%	10.42%	2.08%	NA
Intermediate	90	32.20%	40.00%	13.33%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0136576949	A -> G	LOC_Os01g63110.1	upstream_gene_variant ; 4940.0bp to feature; MODIFIER	silent_mutation	Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638	N	N	N	N
vg0136576949	A -> G	LOC_Os01g63130.1	downstream_gene_variant ; 3897.0bp to feature; MODIFIER	silent_mutation	Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638	N	N	N	N
vg0136576949	A -> G	LOC_Os01g63120.1	intron_variant ; MODIFIER	silent_mutation	Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638	N	N	N	N
vg0136576949	A -> DEL	N	N	silent_mutation	Average:20.171; most accessible tissue: Minghui63 young leaf, score: 32.638	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0136576949	3.89E-06	3.89E-06	mr1358	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	5.70E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	8.72E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	8.83E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	5.89E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	2.05E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	3.76E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	6.78E-08	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	5.30E-06	mr1622	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	5.70E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136576949	NA	4.78E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251