Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136277359:

Variant ID: vg0136277359 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 36277359
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATGACAGTTGCTGTTCCTTTAAGGTCATGAGCACTCGGTTTGGAAATACTCCTCCGTTCCTTTAAAAAAAAATTTAATCTACAAAGAGATGTGACCCCTA[C/T]
TAAGATAACGAATATGTACGAATGATAGTTTAGATTCATTATACTCTGGTTTTAGACCCTTGTATTTTTCACTATAGTCTACACATTAACCAAAATACAT

Reverse complement sequence

ATGTATTTTGGTTAATGTGTAGACTATAGTGAAAAATACAAGGGTCTAAAACCAGAGTATAATGAATCTAAACTATCATTCGTACATATTCGTTATCTTA[G/A]
TAGGGGTCACATCTCTTTGTAGATTAAATTTTTTTTTAAAGGAACGGAGGAGTATTTCCAAACCGAGTGCTCATGACCTTAAAGGAACAGCAACTGTCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	46.10%	0.19%	0.00%	NA
All Indica	2759	27.10%	72.60%	0.25%	0.00%	NA
All Japonica	1512	98.20%	1.80%	0.00%	0.00%	NA
Aus	269	56.50%	43.50%	0.00%	0.00%	NA
Indica I	595	12.10%	87.70%	0.17%	0.00%	NA
Indica II	465	5.20%	94.80%	0.00%	0.00%	NA
Indica III	913	41.90%	57.90%	0.11%	0.00%	NA
Indica Intermediate	786	34.20%	65.10%	0.64%	0.00%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	68.90%	30.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0136277359	C -> T	LOC_Os01g62640.1	upstream_gene_variant ; 2626.0bp to feature; MODIFIER	silent_mutation	Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432	N	N	N	N
vg0136277359	C -> T	LOC_Os01g62650.1	upstream_gene_variant ; 1594.0bp to feature; MODIFIER	silent_mutation	Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432	N	N	N	N
vg0136277359	C -> T	LOC_Os01g62650.2	upstream_gene_variant ; 1594.0bp to feature; MODIFIER	silent_mutation	Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432	N	N	N	N
vg0136277359	C -> T	LOC_Os01g62640-LOC_Os01g62650	intergenic_region ; MODIFIER	silent_mutation	Average:69.464; most accessible tissue: Zhenshan97 root, score: 85.432	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0136277359	NA	1.97E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	NA	1.89E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	NA	9.05E-32	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	NA	1.23E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	2.47E-06	2.11E-10	mr1887	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	NA	2.94E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	NA	2.67E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	NA	1.33E-06	mr1364_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	NA	3.09E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	NA	1.64E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136277359	NA	6.29E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251