Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136272218:

Variant ID: vg0136272218 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 36272218
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

CCCGCATGGCCGGCTGTGGGCTGCGGCTGCTGCCGCCGGGAGGACGACGTCGATCGCGATTATAGTTTAATGGCGCGCGCAGTTGCATGTAGTTGTCGAG[G/A]
CAGCTGCTGCTGGCTGCTGCGCGCGCGGAGCGGAGGCGAAGCAATCTGGAAATTGCCATGTTTGTGAACAGGGAGCGCTGTCAGCTGTGGACCTGATCTC

Reverse complement sequence

GAGATCAGGTCCACAGCTGACAGCGCTCCCTGTTCACAAACATGGCAATTTCCAGATTGCTTCGCCTCCGCTCCGCGCGCGCAGCAGCCAGCAGCAGCTG[C/T]
CTCGACAACTACATGCAACTGCGCGCGCCATTAAACTATAATCGCGATCGACGTCGTCCTCCCGGCGGCAGCAGCCGCAGCCCACAGCCGGCCATGCGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.20%	28.70%	1.16%	0.00%	NA
All Indica	2759	50.60%	47.60%	1.81%	0.00%	NA
All Japonica	1512	98.60%	1.30%	0.07%	0.00%	NA
Aus	269	97.80%	1.10%	1.12%	0.00%	NA
Indica I	595	45.00%	48.70%	6.22%	0.00%	NA
Indica II	465	22.40%	77.20%	0.43%	0.00%	NA
Indica III	913	63.50%	36.40%	0.11%	0.00%	NA
Indica Intermediate	786	56.50%	42.20%	1.27%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	1.70%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0136272218	G -> A	LOC_Os01g62630.1	upstream_gene_variant ; 2481.0bp to feature; MODIFIER	silent_mutation	Average:97.675; most accessible tissue: Minghui63 young leaf, score: 99.313	N	N	N	N
vg0136272218	G -> A	LOC_Os01g62640.1	downstream_gene_variant ; 1808.0bp to feature; MODIFIER	silent_mutation	Average:97.675; most accessible tissue: Minghui63 young leaf, score: 99.313	N	N	N	N
vg0136272218	G -> A	LOC_Os01g62630-LOC_Os01g62640	intergenic_region ; MODIFIER	silent_mutation	Average:97.675; most accessible tissue: Minghui63 young leaf, score: 99.313	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0136272218	G	A	-0.08	0.0	0.0	0.0	0.02	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0136272218	NA	3.96E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	7.29E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	4.02E-06	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	1.98E-06	2.62E-08	mr1517	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	4.95E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	3.46E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	3.72E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	2.20E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	3.11E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	7.42E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	3.89E-06	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	5.70E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	7.31E-06	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136272218	NA	9.92E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251