Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136067759:

Variant ID: vg0136067759 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 36067759
Reference Allele: C	Alternative Allele: T,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.05, G: 0.05, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGACGACTTGCGTTCTCGGGATTAGTGCTTCCATCTTTATGACACT[C/T,G]
TAATCTTGTTTATGTAATTCGTCGAGTTATCATATATCCTACATAATCCCTGGCAATATTGATATCTAACCTACAATCGGCTAACGTCCGTCAATAGAAG

Reverse complement sequence

CTTCTATTGACGGACGTTAGCCGATTGTAGGTTAGATATCAATATTGCCAGGGATTATGTAGGATATATGATAACTCGACGAATTACATAAACAAGATTA[G/A,C]
AGTGTCATAAAGATGGAAGCACTAATCCCGAGAACGCAAGTCGTCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.90%	16.30%	0.13%	0.00%	G: 2.71%
All Indica	2759	74.60%	24.60%	0.22%	0.00%	G: 0.58%
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	58.70%	0.40%	0.00%	0.00%	G: 40.89%
Indica I	595	88.40%	11.40%	0.17%	0.00%	NA
Indica II	465	95.10%	4.90%	0.00%	0.00%	NA
Indica III	913	59.60%	39.80%	0.22%	0.00%	G: 0.44%
Indica Intermediate	786	69.50%	28.60%	0.38%	0.00%	G: 1.53%
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	84.40%	13.30%	0.00%	0.00%	G: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0136067759	C -> G	LOC_Os01g62320.1	upstream_gene_variant ; 960.0bp to feature; MODIFIER	silent_mutation	Average:21.722; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0136067759	C -> G	LOC_Os01g62310-LOC_Os01g62320	intergenic_region ; MODIFIER	silent_mutation	Average:21.722; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0136067759	C -> T	LOC_Os01g62320.1	upstream_gene_variant ; 960.0bp to feature; MODIFIER	silent_mutation	Average:21.722; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0136067759	C -> T	LOC_Os01g62310-LOC_Os01g62320	intergenic_region ; MODIFIER	silent_mutation	Average:21.722; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0136067759	NA	2.27E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136067759	NA	7.25E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136067759	4.79E-06	3.60E-10	mr1887	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136067759	NA	3.63E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136067759	NA	4.66E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136067759	NA	5.30E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136067759	NA	1.26E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136067759	NA	3.28E-07	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136067759	NA	3.63E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251