Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135718510:

Variant ID: vg0135718510 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35718510
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGGCTGATAGCTGGGCTATTAGGTATTGCATGATTGATATAACCCTGGCATTTATCATTAGGATGCGCAACGTACGTATCAGCTGAAATGCTCAAAC[G/A]
GCATACTTTTCGCTTGCTTCACCTAAAGAAAGTCAGAAAAAATCAGCTGTCCATTGCTCCATTTTGCTGAACATGGGTTCACGTCACAACGTGGCCGCGC

Reverse complement sequence

GCGCGGCCACGTTGTGACGTGAACCCATGTTCAGCAAAATGGAGCAATGGACAGCTGATTTTTTCTGACTTTCTTTAGGTGAAGCAAGCGAAAAGTATGC[C/T]
GTTTGAGCATTTCAGCTGATACGTACGTTGCGCATCCTAATGATAAATGCCAGGGTTATATCAATCATGCAATACCTAATAGCCCAGCTATCAGCCTATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 4.20% 2.45% 0.00% NA
All Indica  2759 88.90% 7.20% 3.88% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 98.10% 0.00% 1.86% 0.00% NA
Indica I  595 72.40% 13.30% 14.29% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 91.10% 8.50% 0.33% 0.00% NA
Indica Intermediate  786 92.40% 5.20% 2.42% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135718510 G -> A LOC_Os01g61750.1 upstream_gene_variant ; 2209.0bp to feature; MODIFIER silent_mutation Average:75.89; most accessible tissue: Minghui63 flag leaf, score: 99.95 N N N N
vg0135718510 G -> A LOC_Os01g61720.3 upstream_gene_variant ; 4848.0bp to feature; MODIFIER silent_mutation Average:75.89; most accessible tissue: Minghui63 flag leaf, score: 99.95 N N N N
vg0135718510 G -> A LOC_Os01g61730.1 downstream_gene_variant ; 3520.0bp to feature; MODIFIER silent_mutation Average:75.89; most accessible tissue: Minghui63 flag leaf, score: 99.95 N N N N
vg0135718510 G -> A LOC_Os01g61760.1 downstream_gene_variant ; 2511.0bp to feature; MODIFIER silent_mutation Average:75.89; most accessible tissue: Minghui63 flag leaf, score: 99.95 N N N N
vg0135718510 G -> A LOC_Os01g61760.2 downstream_gene_variant ; 2511.0bp to feature; MODIFIER silent_mutation Average:75.89; most accessible tissue: Minghui63 flag leaf, score: 99.95 N N N N
vg0135718510 G -> A LOC_Os01g61760.3 downstream_gene_variant ; 2511.0bp to feature; MODIFIER silent_mutation Average:75.89; most accessible tissue: Minghui63 flag leaf, score: 99.95 N N N N
vg0135718510 G -> A LOC_Os01g61760.4 downstream_gene_variant ; 2511.0bp to feature; MODIFIER silent_mutation Average:75.89; most accessible tissue: Minghui63 flag leaf, score: 99.95 N N N N
vg0135718510 G -> A LOC_Os01g61730-LOC_Os01g61750 intergenic_region ; MODIFIER silent_mutation Average:75.89; most accessible tissue: Minghui63 flag leaf, score: 99.95 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0135718510 G A -0.01 -0.01 -0.01 0.0 -0.03 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135718510 NA 4.18E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135718510 NA 2.08E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 3.17E-06 mr1306 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 1.99E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 4.66E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 4.26E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 1.31E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 4.10E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 2.43E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 1.69E-10 mr1839 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 8.55E-07 mr1901 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 8.95E-08 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 3.90E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 2.65E-06 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 3.66E-06 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 1.06E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 4.61E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 8.38E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 4.48E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 1.01E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 4.37E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 1.00E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 7.72E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 7.28E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 9.40E-08 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135718510 NA 5.15E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251