Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135647035:

Variant ID: vg0135647035 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35647035
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGTGAGGAGATAACTCTCGCTTTGATCGAGTGCGACGTTTGCGACGTGGCTACCAACCAGAACAAGTCCAGGACGCCATGCAATCGCTACACCACAAA[C/T]
GATGTCGTACCAACCGTGACGAGTGGTTGATGATCCCTGCAATGCAAATGAGAGAACACTGCAAGAACAAGATAAGATGCAATCTAAATATTGCGAATAG

Reverse complement sequence

CTATTCGCAATATTTAGATTGCATCTTATCTTGTTCTTGCAGTGTTCTCTCATTTGCATTGCAGGGATCATCAACCACTCGTCACGGTTGGTACGACATC[G/A]
TTTGTGGTGTAGCGATTGCATGGCGTCCTGGACTTGTTCTGGTTGGTAGCCACGTCGCAAACGTCGCACTCGATCAAAGCGAGAGTTATCTCCTCACCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	30.90%	0.08%	0.00%	NA
All Indica	2759	54.10%	45.70%	0.14%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	35.70%	64.30%	0.00%	0.00%	NA
Indica I	595	59.70%	40.20%	0.17%	0.00%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	28.70%	71.20%	0.11%	0.00%	NA
Indica Intermediate	786	55.50%	44.30%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135647035	C -> T	LOC_Os01g61610-LOC_Os01g61620	intergenic_region ; MODIFIER	silent_mutation	Average:36.825; most accessible tissue: Zhenshan97 root, score: 59.664	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135647035	NA	4.29E-23	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135647035	8.49E-07	1.79E-28	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135647035	NA	2.43E-07	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	1.45E-06	mr1011	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	1.32E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	4.15E-07	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	2.12E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	1.40E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	2.11E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	1.21E-07	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	2.68E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	4.20E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	1.91E-06	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	2.33E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	9.18E-07	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	2.00E-10	mr1277_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	5.20E-09	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	1.08E-10	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	1.20E-10	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	8.60E-07	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	1.57E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135647035	NA	4.16E-06	mr1681_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251