Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135593600:

Variant ID: vg0135593600 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35593600
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CGAAAACTTTTAGCGGAAATAAAAGTTACCCTCAAAATCGACGGAGATCGGTCTGACCGAAGTTGCCTTGCCAGTCTGACCGCTCGGATGTCGTCGGTCT[G/A]
ACCGGTATAGATCAACCGGTCTGACCGCTGAAGCTGCTTGCCGCGCCTGTCGTCACCTCCGGTCTGACCGCCGTGCACCCGCCGGTCTGACCGCCGCTTG

Reverse complement sequence

CAAGCGGCGGTCAGACCGGCGGGTGCACGGCGGTCAGACCGGAGGTGACGACAGGCGCGGCAAGCAGCTTCAGCGGTCAGACCGGTTGATCTATACCGGT[C/T]
AGACCGACGACATCCGAGCGGTCAGACTGGCAAGGCAACTTCGGTCAGACCGATCTCCGTCGATTTTGAGGGTAACTTTTATTTCCGCTAAAAGTTTTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	10.60%	33.58%	2.67%	NA
All Indica	2759	27.10%	17.20%	51.25%	4.42%	NA
All Japonica	1512	98.60%	0.30%	0.93%	0.13%	NA
Aus	269	43.90%	6.30%	49.44%	0.37%	NA
Indica I	595	41.80%	7.90%	42.52%	7.73%	NA
Indica II	465	23.20%	17.80%	50.75%	8.17%	NA
Indica III	913	18.80%	25.20%	53.56%	2.41%	NA
Indica Intermediate	786	28.00%	14.50%	55.47%	2.04%	NA
Temperate Japonica	767	99.00%	0.10%	0.91%	0.00%	NA
Tropical Japonica	504	98.40%	0.60%	0.60%	0.40%	NA
Japonica Intermediate	241	97.90%	0.40%	1.66%	0.00%	NA
VI/Aromatic	96	94.80%	1.00%	4.17%	0.00%	NA
Intermediate	90	70.00%	4.40%	24.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135593600	G -> A	LOC_Os01g61520.1	upstream_gene_variant ; 2433.0bp to feature; MODIFIER	silent_mutation	Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0135593600	G -> A	LOC_Os01g61540.1	upstream_gene_variant ; 1342.0bp to feature; MODIFIER	silent_mutation	Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0135593600	G -> A	LOC_Os01g61530.1	downstream_gene_variant ; 142.0bp to feature; MODIFIER	silent_mutation	Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0135593600	G -> A	LOC_Os01g61550.1	downstream_gene_variant ; 3492.0bp to feature; MODIFIER	silent_mutation	Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0135593600	G -> A	LOC_Os01g61530-LOC_Os01g61540	intergenic_region ; MODIFIER	silent_mutation	Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0135593600	G -> DEL	N	N	silent_mutation	Average:62.191; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135593600	2.19E-07	NA	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135593600	2.96E-07	9.65E-10	mr1517	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135593600	NA	5.74E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135593600	NA	2.67E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135593600	NA	2.75E-07	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251