Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135297102:

Variant ID: vg0135297102 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35297102
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGCCGGGCCCGCTTACATCTAATAGCTTTCATAGGTCATAGACTGTCCCATGGCGTGAATTAATATACCACTTAGTCATTAACCCATTGTAACGTCTC[G/A]
CCTCTTCCCAGGCCGGGCCCGCTTACATCTGATAGTTTTCATAGGTCATAGACTGTCCCTCTGTGAACTCGTGCGTACCCGGGAAGAATTCTTTGCAGAT

Reverse complement sequence

ATCTGCAAAGAATTCTTCCCGGGTACGCACGAGTTCACAGAGGGACAGTCTATGACCTATGAAAACTATCAGATGTAAGCGGGCCCGGCCTGGGAAGAGG[C/T]
GAGACGTTACAATGGGTTAATGACTAAGTGGTATATTAATTCACGCCATGGGACAGTCTATGACCTATGAAAGCTATTAGATGTAAGCGGGCCCGGCCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.50% 1.50% 0.34% 51.67% NA
All Indica  2759 11.40% 2.50% 0.51% 85.54% NA
All Japonica  1512 98.30% 0.00% 0.07% 1.65% NA
Aus  269 90.30% 0.40% 0.00% 9.29% NA
Indica I  595 7.60% 3.70% 0.50% 88.24% NA
Indica II  465 2.20% 2.40% 0.43% 95.05% NA
Indica III  913 15.20% 1.50% 0.22% 83.02% NA
Indica Intermediate  786 15.40% 2.90% 0.89% 80.79% NA
Temperate Japonica  767 98.80% 0.00% 0.00% 1.17% NA
Tropical Japonica  504 97.40% 0.00% 0.20% 2.38% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 65.60% 0.00% 1.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135297102 G -> A LOC_Os01g61000.1 upstream_gene_variant ; 2339.0bp to feature; MODIFIER silent_mutation Average:62.035; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 N N N N
vg0135297102 G -> A LOC_Os01g61000-LOC_Os01g61010 intergenic_region ; MODIFIER silent_mutation Average:62.035; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 N N N N
vg0135297102 G -> DEL N N silent_mutation Average:62.035; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135297102 NA 1.07E-24 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 2.73E-10 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 9.88E-12 1.26E-15 mr1008 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 7.39E-11 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 2.36E-13 2.18E-16 mr1009 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 2.27E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 3.30E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 2.46E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 2.79E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 3.62E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 3.62E-08 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 2.46E-09 1.27E-13 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 1.30E-27 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 5.13E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 2.59E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 1.08E-18 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 1.26E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 1.70E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 5.70E-11 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 4.21E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135297102 NA 9.83E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251