Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135124935:

Variant ID: vg0135124935 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35124935
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

AGACCACATGCGACCCTCCGAGAGGATGGACTCTAGAACCACGGAGACCGAGAAAAGTGCCGAGTCGAAAACTTTGAAGTCATGCTCCTTCCACAACTGA[C/T]
AAGAGACTAGGAGAACCAGAGAGTCGAAGCCGGTACAAAAATGCTAAGGTAAACAGGCCCTAGACGACGGCCACCAGACCGCTAGCGAGTTGTATATGTA

Reverse complement sequence

TACATATACAACTCGCTAGCGGTCTGGTGGCCGTCGTCTAGGGCCTGTTTACCTTAGCATTTTTGTACCGGCTTCGACTCTCTGGTTCTCCTAGTCTCTT[G/A]
TCAGTTGTGGAAGGAGCATGACTTCAAAGTTTTCGACTCGGCACTTTTCTCGGTCTCCGTGGTTCTAGAGTCCATCCTCTCGGAGGGTCGCATGTGGTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	9.70%	0.06%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	70.70%	29.10%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	30.40%	69.00%	0.60%	0.00%	NA
Japonica Intermediate	241	66.80%	33.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135124935	C -> T	LOC_Os01g60720.1	upstream_gene_variant ; 4935.0bp to feature; MODIFIER	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 90.286	N	N	N	N
vg0135124935	C -> T	LOC_Os01g60730.1	upstream_gene_variant ; 1949.0bp to feature; MODIFIER	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 90.286	N	N	N	N
vg0135124935	C -> T	LOC_Os01g60730.2	upstream_gene_variant ; 1946.0bp to feature; MODIFIER	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 90.286	N	N	N	N
vg0135124935	C -> T	LOC_Os01g60740.1	downstream_gene_variant ; 4923.0bp to feature; MODIFIER	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 90.286	N	N	N	N
vg0135124935	C -> T	LOC_Os01g60730-LOC_Os01g60740	intergenic_region ; MODIFIER	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 90.286	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135124935	NA	9.72E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	3.24E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	4.18E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	1.35E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	7.81E-07	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	3.65E-07	NA	mr1241_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	1.39E-12	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	2.85E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	3.22E-06	mr1319_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	9.11E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	2.34E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	7.70E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	9.18E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	7.63E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	4.01E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	8.00E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	5.58E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	3.00E-06	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	1.09E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	6.42E-10	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	3.09E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	1.89E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	1.14E-08	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135124935	NA	2.70E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251