Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135058637:

Variant ID: vg0135058637 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35058637
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.28, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CTCGCGTATTAGCTTTTATTTATGTAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATATAGAGACTAAAGTTAAGTCCCTG[A/G,T]
ATCCAAACACCATCTTAGGCGTTGATTAGTGGCTGAGAATTGAGATGACCCGCGGGAATCGATCACACGTATCTCAGTTAGTTCTAGGAAGAAACCAATT

Reverse complement sequence

AATTGGTTTCTTCCTAGAACTAACTGAGATACGTGTGATCGATTCCCGCGGGTCATCTCAATTCTCAGCCACTAATCAACGCCTAAGATGGTGTTTGGAT[T/C,A]
CAGGGACTTAACTTTAGTCTCTATATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTACATAAATAAAAGCTAATACGCGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	33.40%	0.11%	0.00%	T: 0.25%
All Indica	2759	97.70%	2.20%	0.11%	0.00%	NA
All Japonica	1512	8.20%	91.70%	0.00%	0.00%	T: 0.07%
Aus	269	96.30%	0.70%	0.37%	0.00%	T: 2.60%
Indica I	595	96.30%	3.50%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	95.40%	4.50%	0.13%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	18.50%	81.50%	0.00%	0.00%	NA
Japonica Intermediate	241	7.90%	91.70%	0.00%	0.00%	T: 0.41%
VI/Aromatic	96	7.30%	88.50%	0.00%	0.00%	T: 4.17%
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135058637	A -> G	LOC_Os01g60640.1	upstream_gene_variant ; 4097.0bp to feature; MODIFIER	silent_mutation	Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0135058637	A -> G	LOC_Os01g60630-LOC_Os01g60640	intergenic_region ; MODIFIER	silent_mutation	Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0135058637	A -> T	LOC_Os01g60640.1	upstream_gene_variant ; 4097.0bp to feature; MODIFIER	silent_mutation	Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0135058637	A -> T	LOC_Os01g60630-LOC_Os01g60640	intergenic_region ; MODIFIER	silent_mutation	Average:40.452; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135058637	NA	6.10E-07	mr1095	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637	NA	4.26E-06	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637	NA	2.07E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637	2.86E-06	2.86E-06	mr1589	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637	1.60E-06	1.60E-06	mr1918	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637	7.52E-06	7.53E-06	mr1996	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135058637	NA	7.67E-06	mr1098_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251