Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134821080:

Variant ID: vg0134821080 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 34821080
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, T: 0.20, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GCCCACGGATTCTGACAGAAATGTAAGTGTAAAACAGAGGATTGCAAAACATAGGAATAACGTAGGAATGACCGTTTGATTGGACCACAGGAAAAATATA[G/T]
GAATTTGAGGAGAGATAAAGACTTAAAAGGATTTTTTCTATGAGGTTCTACCTCTTGTTAAAATTCCTCCAAAACTTGTATGGGAAAAGGCATTCCATAG

Reverse complement sequence

CTATGGAATGCCTTTTCCCATACAAGTTTTGGAGGAATTTTAACAAGAGGTAGAACCTCATAGAAAAAATCCTTTTAAGTCTTTATCTCTCCTCAAATTC[C/A]
TATATTTTTCCTGTGGTCCAATCAAACGGTCATTCCTACGTTATTCCTATGTTTTGCAATCCTCTGTTTTACACTTACATTTCTGTCAGAATCCGTGGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 39.30% 0.06% 0.00% NA
All Indica  2759 97.40% 2.60% 0.04% 0.00% NA
All Japonica  1512 2.20% 97.80% 0.00% 0.00% NA
Aus  269 39.40% 60.60% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 5.20% 0.13% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 3.00% 97.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 34.40% 63.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0134821080 G -> T LOC_Os01g60210.1 upstream_gene_variant ; 1898.0bp to feature; MODIFIER silent_mutation Average:38.708; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0134821080 G -> T LOC_Os01g60220.1 downstream_gene_variant ; 2865.0bp to feature; MODIFIER silent_mutation Average:38.708; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N
vg0134821080 G -> T LOC_Os01g60200-LOC_Os01g60210 intergenic_region ; MODIFIER silent_mutation Average:38.708; most accessible tissue: Zhenshan97 flag leaf, score: 76.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0134821080 1.49E-06 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 1.09E-07 1.61E-11 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 2.64E-06 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 4.36E-07 8.87E-11 mr1009 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 2.84E-06 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 6.94E-08 1.06E-11 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 5.85E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 9.97E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 6.57E-14 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 9.62E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 2.76E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 4.75E-22 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 3.36E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 2.92E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 5.69E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 5.78E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134821080 NA 2.50E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251