Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134387944:

Variant ID: vg0134387944 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34387944
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

CATCTACCCTAGACTTTTCTGTCACAAAGCTAATGCCTTAACTAACTTTTTGTGAAAAATCTATGATCGTGTTTAGTTCTATCCATAGATTGGTTTGGTC[C/A]
TTTTAAATAGCATCTCATGTCATCTTTACCCTGCATATTTGAACTATTCCCTTATGATTCAGCTCCTTATTCTGTTGTGCTGTTAATTATCTCCTTGTGT

Reverse complement sequence

ACACAAGGAGATAATTAACAGCACAACAGAATAAGGAGCTGAATCATAAGGGAATAGTTCAAATATGCAGGGTAAAGATGACATGAGATGCTATTTAAAA[G/T]
GACCAAACCAATCTATGGATAGAACTAAACACGATCATAGATTTTTCACAAAAAGTTAGTTAAGGCATTAGCTTTGTGACAGAAAAGTCTAGGGTAGATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.70%	14.20%	0.15%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	63.50%	36.10%	0.40%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	86.60%	12.60%	0.78%	0.00%	NA
Tropical Japonica	504	39.30%	60.70%	0.00%	0.00%	NA
Japonica Intermediate	241	40.70%	59.30%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	68.90%	30.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134387944	C -> A	LOC_Os01g59440.1	downstream_gene_variant ; 4860.0bp to feature; MODIFIER	silent_mutation	Average:53.915; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0134387944	C -> A	LOC_Os01g59440.3	downstream_gene_variant ; 4860.0bp to feature; MODIFIER	silent_mutation	Average:53.915; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0134387944	C -> A	LOC_Os01g59450.1	intron_variant ; MODIFIER	silent_mutation	Average:53.915; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134387944	NA	4.70E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944	9.06E-08	NA	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944	3.93E-06	NA	mr1693	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944	1.59E-09	NA	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944	4.09E-07	1.49E-06	mr1720	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944	NA	3.88E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944	NA	1.58E-06	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944	NA	8.41E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134387944	NA	1.49E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251