Variant ID: vg0134387944 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 34387944 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )
CATCTACCCTAGACTTTTCTGTCACAAAGCTAATGCCTTAACTAACTTTTTGTGAAAAATCTATGATCGTGTTTAGTTCTATCCATAGATTGGTTTGGTC[C/A]
TTTTAAATAGCATCTCATGTCATCTTTACCCTGCATATTTGAACTATTCCCTTATGATTCAGCTCCTTATTCTGTTGTGCTGTTAATTATCTCCTTGTGT
ACACAAGGAGATAATTAACAGCACAACAGAATAAGGAGCTGAATCATAAGGGAATAGTTCAAATATGCAGGGTAAAGATGACATGAGATGCTATTTAAAA[G/T]
GACCAAACCAATCTATGGATAGAACTAAACACGATCATAGATTTTTCACAAAAAGTTAGTTAAGGCATTAGCTTTGTGACAGAAAAGTCTAGGGTAGATG
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 85.70% | 14.20% | 0.15% | 0.00% | NA |
All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 63.50% | 36.10% | 0.40% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 86.60% | 12.60% | 0.78% | 0.00% | NA |
Tropical Japonica | 504 | 39.30% | 60.70% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 40.70% | 59.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
Intermediate | 90 | 68.90% | 30.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0134387944 | C -> A | LOC_Os01g59440.1 | downstream_gene_variant ; 4860.0bp to feature; MODIFIER | silent_mutation | Average:53.915; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
vg0134387944 | C -> A | LOC_Os01g59440.3 | downstream_gene_variant ; 4860.0bp to feature; MODIFIER | silent_mutation | Average:53.915; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
vg0134387944 | C -> A | LOC_Os01g59450.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.915; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0134387944 | NA | 4.70E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134387944 | 9.06E-08 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134387944 | 3.93E-06 | NA | mr1693 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134387944 | 1.59E-09 | NA | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134387944 | 4.09E-07 | 1.49E-06 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134387944 | NA | 3.88E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134387944 | NA | 1.58E-06 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134387944 | NA | 8.41E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134387944 | NA | 1.49E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |