Variant ID: vg0134374494 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 34374494 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 263. )
CTAACGCAACCTATAGAGTTTGTAGCTTTCTACTTGGTAGGGACAGGGGTTCGTGGTAGACTTACTTGTCTATGCAGGCGTGAAACAATCTTCCTTTCCT[C/T]
TGGACTTTGAGGCGGCCGGGCTGTGTTTCCCCAGCGGCCACCCAGTGGCGGCAGATTTGACCACAAGCAGCTTAGACCCAGTTGCTATGGGGAACAAAGG
CCTTTGTTCCCCATAGCAACTGGGTCTAAGCTGCTTGTGGTCAAATCTGCCGCCACTGGGTGGCCGCTGGGGAAACACAGCCCGGCCGCCTCAAAGTCCA[G/A]
AGGAAAGGAAGATTGTTTCACGCCTGCATAGACAAGTAAGTCTACCACGAACCCCTGTCCCTACCAAGTAGAAAGCTACAAACTCTATAGGTTGCGTTAG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 84.80% | 15.10% | 0.04% | 0.00% | NA |
All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 62.60% | 37.30% | 0.07% | 0.00% | NA |
Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 86.70% | 13.20% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 40.20% | 59.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 10.40% | 88.50% | 1.04% | 0.00% | NA |
Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0134374494 | C -> T | LOC_Os01g59440.1 | upstream_gene_variant ; 4602.0bp to feature; MODIFIER | silent_mutation | Average:44.597; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
vg0134374494 | C -> T | LOC_Os01g59440.2 | upstream_gene_variant ; 4602.0bp to feature; MODIFIER | silent_mutation | Average:44.597; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
vg0134374494 | C -> T | LOC_Os01g59430.1 | downstream_gene_variant ; 1364.0bp to feature; MODIFIER | silent_mutation | Average:44.597; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
vg0134374494 | C -> T | LOC_Os01g59420-LOC_Os01g59430 | intergenic_region ; MODIFIER | silent_mutation | Average:44.597; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0134374494 | NA | 8.10E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134374494 | 6.35E-08 | NA | mr1679 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134374494 | 1.04E-11 | 8.95E-12 | mr1720 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134374494 | 3.41E-08 | 3.44E-07 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134374494 | NA | 8.09E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134374494 | NA | 6.97E-06 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134374494 | NA | 4.51E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134374494 | NA | 1.22E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0134374494 | NA | 2.35E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |