Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0134197545:

Variant ID: vg0134197545 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 34197545
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAATTTGGAATTAAAAATAAGAAATATAAGAAGTAGAGTATAGAATCCATATAGAAATACAATTAGGAAATAAATAAAAATTCGGAATTAAAAATAAC[G/T]
AATATTAGAAGTAGAGTATAGAGTCCATAAAGAAATACAATTAAGAAAGAAAAATAGAAATTCAGAATTAAAAAATAAGGAATATTAGAAGTAGAGTATA

Reverse complement sequence

TATACTCTACTTCTAATATTCCTTATTTTTTAATTCTGAATTTCTATTTTTCTTTCTTAATTGTATTTCTTTATGGACTCTATACTCTACTTCTAATATT[C/A]
GTTATTTTTAATTCCGAATTTTTATTTATTTCCTAATTGTATTTCTATATGGATTCTATACTCTACTTCTTATATTTCTTATTTTTAATTCCAAATTTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	3.30%	1.29%	2.67%	NA
All Indica	2759	97.50%	0.10%	0.94%	1.52%	NA
All Japonica	1512	82.90%	9.60%	2.12%	5.42%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.00%	0.17%	0.34%	NA
Indica II	465	92.70%	0.20%	3.01%	4.09%	NA
Indica III	913	98.80%	0.10%	0.22%	0.88%	NA
Indica Intermediate	786	97.20%	0.00%	1.15%	1.65%	NA
Temperate Japonica	767	94.50%	0.00%	0.52%	4.95%	NA
Tropical Japonica	504	66.30%	28.00%	2.98%	2.78%	NA
Japonica Intermediate	241	80.50%	1.70%	5.39%	12.45%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	87.80%	7.80%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0134197545	G -> T	LOC_Os01g59200.1	upstream_gene_variant ; 3974.0bp to feature; MODIFIER	silent_mutation	Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0134197545	G -> T	LOC_Os01g59190.1	downstream_gene_variant ; 3376.0bp to feature; MODIFIER	silent_mutation	Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0134197545	G -> T	LOC_Os01g59190-LOC_Os01g59200	intergenic_region ; MODIFIER	silent_mutation	Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0134197545	G -> DEL	N	N	silent_mutation	Average:20.379; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0134197545	4.27E-07	NA	mr1925	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134197545	NA	2.24E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0134197545	NA	2.09E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251