Variant ID: vg0133884657 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 33884657 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )
ATAGATAATATTATAACATACTCTTTTTATTTGTAGGAAGCACTTGCATTTAGCTAGTATATATGCAGTTTGATCCTTCAATTATGTTCGGTTCTTTTGA[A/G]
ATTATCTTCTCCCGTTGTTGCAACGAGAATTTTGCTACTAAATTAAAATGAAAAAAGAAAAAAGTTTGAAAAGAAAGTTTTCTATAAGGGACCGAAGCTT
AAGCTTCGGTCCCTTATAGAAAACTTTCTTTTCAAACTTTTTTCTTTTTTCATTTTAATTTAGTAGCAAAATTCTCGTTGCAACAACGGGAGAAGATAAT[T/C]
TCAAAAGAACCGAACATAATTGAAGGATCAAACTGCATATATACTAGCTAAATGCAAGTGCTTCCTACAAATAAAAAGAGTATGTTATAATATTATCTAT
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 88.60% | 8.60% | 2.56% | 0.30% | NA |
All Indica | 2759 | 98.00% | 1.80% | 0.07% | 0.14% | NA |
All Japonica | 1512 | 69.30% | 22.50% | 7.54% | 0.66% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 96.60% | 3.20% | 0.00% | 0.17% | NA |
Indica II | 465 | 98.90% | 0.60% | 0.22% | 0.22% | NA |
Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 96.80% | 2.80% | 0.13% | 0.25% | NA |
Temperate Japonica | 767 | 54.50% | 32.50% | 11.86% | 1.17% | NA |
Tropical Japonica | 504 | 89.50% | 8.50% | 1.98% | 0.00% | NA |
Japonica Intermediate | 241 | 74.30% | 19.90% | 5.39% | 0.41% | NA |
VI/Aromatic | 96 | 94.80% | 2.10% | 3.12% | 0.00% | NA |
Intermediate | 90 | 82.20% | 15.60% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0133884657 | A -> G | LOC_Os01g58600.1 | upstream_gene_variant ; 2367.0bp to feature; MODIFIER | silent_mutation | Average:63.472; most accessible tissue: Zhenshan97 flower, score: 81.855 | N | N | N | N |
vg0133884657 | A -> G | LOC_Os01g58610.1 | upstream_gene_variant ; 263.0bp to feature; MODIFIER | silent_mutation | Average:63.472; most accessible tissue: Zhenshan97 flower, score: 81.855 | N | N | N | N |
vg0133884657 | A -> G | LOC_Os01g58600-LOC_Os01g58610 | intergenic_region ; MODIFIER | silent_mutation | Average:63.472; most accessible tissue: Zhenshan97 flower, score: 81.855 | N | N | N | N |
vg0133884657 | A -> DEL | N | N | silent_mutation | Average:63.472; most accessible tissue: Zhenshan97 flower, score: 81.855 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0133884657 | 2.69E-08 | 3.60E-14 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133884657 | 8.91E-06 | 3.40E-07 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133884657 | 8.19E-07 | 7.32E-12 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133884657 | NA | 4.75E-06 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133884657 | 2.49E-09 | 6.98E-16 | mr1650 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133884657 | 2.38E-06 | 1.94E-07 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133884657 | 9.26E-07 | 3.04E-11 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133884657 | NA | 3.43E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133884657 | NA | 5.90E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |