Variant ID: vg0133772255 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 33772255 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.10, others allele: 0.00, population size: 103. )
CGTGATCCGGGATGATATAATAAACCATGTTTAGGGACCATGATATACACTTTATAAGTTTATGGACCTAGATAAAACTTGCTTACAAGTTTAAGGACCA[C/T]
CAGTGTAATTTACTCTGTACAATATTCAACGGATAAATTATACGTCCGTCTGTCCGTCACTTATGGAGACGGAGGGAGTAGCTCATTAACGCTCATTTTA
TAAAATGAGCGTTAATGAGCTACTCCCTCCGTCTCCATAAGTGACGGACAGACGGACGTATAATTTATCCGTTGAATATTGTACAGAGTAAATTACACTG[G/A]
TGGTCCTTAAACTTGTAAGCAAGTTTTATCTAGGTCCATAAACTTATAAAGTGTATATCATGGTCCCTAAACATGGTTTATTATATCATCCCGGATCACG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 35.70% | 14.30% | 7.96% | 42.04% | NA |
All Indica | 2759 | 3.60% | 20.60% | 12.11% | 63.72% | NA |
All Japonica | 1512 | 95.00% | 2.70% | 1.19% | 1.12% | NA |
Aus | 269 | 1.10% | 20.10% | 8.18% | 70.63% | NA |
Indica I | 595 | 7.10% | 27.90% | 25.55% | 39.50% | NA |
Indica II | 465 | 1.30% | 3.90% | 3.01% | 91.83% | NA |
Indica III | 913 | 1.40% | 28.40% | 8.87% | 61.34% | NA |
Indica Intermediate | 786 | 4.70% | 16.00% | 11.07% | 68.19% | NA |
Temperate Japonica | 767 | 94.50% | 2.90% | 1.69% | 0.91% | NA |
Tropical Japonica | 504 | 97.80% | 0.20% | 0.99% | 0.99% | NA |
Japonica Intermediate | 241 | 90.50% | 7.50% | 0.00% | 2.07% | NA |
VI/Aromatic | 96 | 95.80% | 1.00% | 0.00% | 3.12% | NA |
Intermediate | 90 | 64.40% | 12.20% | 2.22% | 21.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0133772255 | C -> T | LOC_Os01g58420.1 | downstream_gene_variant ; 4170.0bp to feature; MODIFIER | silent_mutation | Average:57.179; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
vg0133772255 | C -> T | LOC_Os01g58430.1 | downstream_gene_variant ; 1474.0bp to feature; MODIFIER | silent_mutation | Average:57.179; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
vg0133772255 | C -> T | LOC_Os01g58430-LOC_Os01g58440 | intergenic_region ; MODIFIER | silent_mutation | Average:57.179; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
vg0133772255 | C -> DEL | N | N | silent_mutation | Average:57.179; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0133772255 | NA | 1.26E-22 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133772255 | NA | 1.15E-08 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133772255 | 4.67E-20 | 4.49E-147 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133772255 | 7.80E-19 | 4.09E-143 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133772255 | NA | 1.71E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133772255 | 1.14E-09 | 6.67E-87 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133772255 | 8.36E-11 | 6.36E-90 | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133772255 | NA | 1.02E-67 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133772255 | NA | 3.32E-21 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0133772255 | NA | 3.11E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/