RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0133648958:

Variant ID: vg0133648958 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33648958
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, A: 0.45, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTCCATCTCTTATAGTTTGAACCATCAAAAGCATGTGGTTTCAGTGCAGCAGCAAAGCCAACTACCGAAAATGACCTATCAGGTTTTTGGATTGTTGG[C/A]
AATATAGTCATTAATCGGCATATTTTAATCCAAGAAATTGAAACAATGATCATGGCATAAGCAGCGTAGGGTGATCTTAACATAACCAGTAGCATACTAT

Reverse complement sequence

ATAGTATGCTACTGGTTATGTTAAGATCACCCTACGCTGCTTATGCCATGATCATTGTTTCAATTTCTTGGATTAAAATATGCCGATTAATGACTATATT[G/T]
CCAACAATCCAAAAACCTGATAGGTCATTTTCGGTAGTTGGCTTTGCTGCTGCACTGAAACCACATGCTTTTGATGGTTCAAACTATAAGAGATGGAAAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.90%	35.90%	12.21%	13.99%	NA
All Indica	2759	5.70%	53.60%	17.40%	23.31%	NA
All Japonica	1512	97.60%	0.20%	1.46%	0.79%	NA
Aus	269	2.20%	74.00%	23.79%	0.00%	NA
Indica I	595	7.10%	37.80%	15.29%	39.83%	NA
Indica II	465	2.60%	62.20%	13.55%	21.72%	NA
Indica III	913	3.80%	60.00%	22.23%	13.91%	NA
Indica Intermediate	786	8.50%	53.20%	15.65%	22.65%	NA
Temperate Japonica	767	96.30%	0.30%	2.61%	0.78%	NA
Tropical Japonica	504	99.00%	0.00%	0.20%	0.79%	NA
Japonica Intermediate	241	98.30%	0.40%	0.41%	0.83%	NA
VI/Aromatic	96	95.80%	2.10%	2.08%	0.00%	NA
Intermediate	90	70.00%	13.30%	10.00%	6.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133648958	C -> A	LOC_Os01g58220.1	downstream_gene_variant ; 2184.0bp to feature; MODIFIER	silent_mutation	Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529	N	N	N	N
vg0133648958	C -> A	LOC_Os01g58220.2	downstream_gene_variant ; 2184.0bp to feature; MODIFIER	silent_mutation	Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529	N	N	N	N
vg0133648958	C -> A	LOC_Os01g58194.1	intron_variant ; MODIFIER	silent_mutation	Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529	N	N	N	N
vg0133648958	C -> DEL	N	N	silent_mutation	Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133648958	NA	1.37E-24	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958	NA	2.75E-07	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958	6.62E-14	2.80E-139	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958	2.97E-08	7.04E-15	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958	6.19E-14	3.71E-137	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958	3.28E-08	2.38E-14	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958	6.79E-10	9.27E-88	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958	NA	1.80E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958	6.67E-10	7.69E-90	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958	NA	1.60E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 22 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0133648958:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact