Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133400564:

Variant ID: vg0133400564 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33400564
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GAATCAGAATTTTTTTATAAACGCGGGATTTTTCTCACGTTGGGTCAGTTTTTTCGGGGTAGTATTTTTTATATATGGCGGTTTTTTCTCGTGTGAATTC[G/A]
GATGGTTTTTTCTATCTTTTTTTAGCAATGTTTTTTCTGATGGTTTATTTCGGACAAATAGAGCCTCAGTGCACTCTTCTTAATAAAAATTAAAAATATG

Reverse complement sequence

CATATTTTTAATTTTTATTAAGAAGAGTGCACTGAGGCTCTATTTGTCCGAAATAAACCATCAGAAAAAACATTGCTAAAAAAAGATAGAAAAAACCATC[C/T]
GAATTCACACGAGAAAAAACCGCCATATATAAAAAATACTACCCCGAAAAAACTGACCCAACGTGAGAAAAATCCCGCGTTTATAAAAAAATTCTGATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.60%	6.30%	11.19%	38.87%	NA
All Indica	2759	7.90%	8.60%	18.38%	65.10%	NA
All Japonica	1512	99.00%	0.00%	0.00%	0.99%	NA
Aus	269	67.30%	22.70%	6.69%	3.35%	NA
Indica I	595	6.60%	4.40%	22.52%	66.55%	NA
Indica II	465	2.20%	0.60%	7.10%	90.11%	NA
Indica III	913	8.20%	16.30%	22.34%	53.12%	NA
Indica Intermediate	786	12.10%	7.50%	17.30%	63.10%	NA
Temperate Japonica	767	99.10%	0.00%	0.00%	0.91%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	76.70%	2.20%	4.44%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133400564	G -> A	LOC_Os01g57740.1	downstream_gene_variant ; 4473.0bp to feature; MODIFIER	silent_mutation	Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783	N	N	N	N
vg0133400564	G -> A	LOC_Os01g57750.1	downstream_gene_variant ; 2851.0bp to feature; MODIFIER	silent_mutation	Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783	N	N	N	N
vg0133400564	G -> A	LOC_Os01g57760.1	downstream_gene_variant ; 3669.0bp to feature; MODIFIER	silent_mutation	Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783	N	N	N	N
vg0133400564	G -> A	LOC_Os01g57750-LOC_Os01g57760	intergenic_region ; MODIFIER	silent_mutation	Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783	N	N	N	N
vg0133400564	G -> DEL	N	N	silent_mutation	Average:17.946; most accessible tissue: Zhenshan97 flower, score: 33.783	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133400564	NA	3.95E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	2.76E-06	NA	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	NA	1.94E-08	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	1.47E-06	NA	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	4.98E-06	3.07E-08	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	1.46E-06	NA	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	1.52E-08	6.12E-11	mr1008_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	NA	3.71E-10	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	NA	5.53E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	NA	5.60E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133400564	NA	1.47E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251