Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132758241:

Variant ID: vg0132758241 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 32758241
Reference Allele: CAlternative Allele: T,CAACCATATT,CAACCATACCA
Primary Allele: CSecondary Allele: CAACCATATT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTTCGACGGTATCGGGCGTGATCTCCGCCTCTCAAGGGTGAGGCCCCGTCATCGTGGAGACACTTCTCGAGCTATTAAGGGACAGTTCAGATTAATGT[C/T,CAACCATATT,CAACCATACCA]
ATTTTTTTAAGTAAAGTGGCTAAAAAAATATTTACATTTAGGGTCCCTTTGAATCACAAGAATAGAAAAACAGAGGAATAGAAAATACGTAGGATTTTGA

Reverse complement sequence

TCAAAATCCTACGTATTTTCTATTCCTCTGTTTTTCTATTCTTGTGATTCAAAGGGACCCTAAATGTAAATATTTTTTTAGCCACTTTACTTAAAAAAAT[G/A,AATATGGTTG,TGGTATGGTTG]
ACATTAATCTGAACTGTCCCTTAATAGCTCGAGAAGTGTCTCCACGATGACGGGGCCTCACCCTTGAGAGGCGGAGATCACGCCCGATACCGTCGAACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CAACCATATT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.90% 0.60% 0.21% 73.95% T: 0.25%; CAACCATACCA: 0.08%
All Indica  2759 1.00% 0.00% 0.07% 98.59% T: 0.22%; CAACCATACCA: 0.14%
All Japonica  1512 67.30% 1.70% 0.33% 30.42% T: 0.26%
Aus  269 1.50% 0.00% 0.37% 97.77% T: 0.37%
Indica I  595 0.20% 0.00% 0.34% 99.16% T: 0.34%
Indica II  465 1.50% 0.00% 0.00% 98.06% T: 0.43%
Indica III  913 0.00% 0.00% 0.00% 99.67% CAACCATACCA: 0.22%; T: 0.11%
Indica Intermediate  786 2.40% 0.00% 0.00% 97.20% CAACCATACCA: 0.25%; T: 0.13%
Temperate Japonica  767 95.30% 3.40% 0.26% 0.91% T: 0.13%
Tropical Japonica  504 12.70% 0.00% 0.20% 86.71% T: 0.40%
Japonica Intermediate  241 92.10% 0.00% 0.83% 6.64% T: 0.41%
VI/Aromatic  96 96.90% 0.00% 0.00% 2.08% T: 1.04%
Intermediate  90 41.10% 1.10% 2.22% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132758241 C -> T LOC_Os01g56764.1 upstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> T LOC_Os01g56780.1 downstream_gene_variant ; 891.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> T LOC_Os01g56780.3 downstream_gene_variant ; 883.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> T LOC_Os01g56780.2 downstream_gene_variant ; 891.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> T LOC_Os01g56764-LOC_Os01g56780 intergenic_region ; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATACCA LOC_Os01g56764.1 upstream_gene_variant ; 444.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATACCA LOC_Os01g56780.1 downstream_gene_variant ; 890.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATACCA LOC_Os01g56780.3 downstream_gene_variant ; 882.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATACCA LOC_Os01g56780.2 downstream_gene_variant ; 890.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATACCA LOC_Os01g56764-LOC_Os01g56780 intergenic_region ; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATATT LOC_Os01g56764.1 upstream_gene_variant ; 444.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATATT LOC_Os01g56780.1 downstream_gene_variant ; 890.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATATT LOC_Os01g56780.3 downstream_gene_variant ; 882.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATATT LOC_Os01g56780.2 downstream_gene_variant ; 890.0bp to feature; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> CAACCATATT LOC_Os01g56764-LOC_Os01g56780 intergenic_region ; MODIFIER silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0132758241 C -> DEL N N silent_mutation Average:86.303; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0132758241 C CAACC* 0.45 0.39 0.53 0.27 0.43 0.34
vg0132758241 C T 0.04 0.02 0.02 0.02 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132758241 NA 9.25E-18 mr1552 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132758241 NA 1.23E-46 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132758241 NA 1.64E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132758241 NA 3.84E-45 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132758241 NA 1.11E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132758241 NA 1.45E-47 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251