Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131035257:

Variant ID: vg0131035257 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31035257
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGGTTTTTTTTCTATATGCTATTAAGAAAGATGGTGTCTGCCTCGGTGCCACTAAAAAGTTCGAGTCTTTCTCTGTGCCATCGTCGAACTTTATCGCG[T/C]
CCTCCACCCCATTCCGTCGCTATTCTGTTTGGATTTAACTGTTTGGCAGCTCTGACATGTGGGTCCGGGAAGGAACAATGTCCCTCTTGCCCTTTCACTC

Reverse complement sequence

GAGTGAAAGGGCAAGAGGGACATTGTTCCTTCCCGGACCCACATGTCAGAGCTGCCAAACAGTTAAATCCAAACAGAATAGCGACGGAATGGGGTGGAGG[A/G]
CGCGATAAAGTTCGACGATGGCACAGAGAAAGACTCGAACTTTTTAGTGGCACCGAGGCAGACACCATCTTTCTTAATAGCATATAGAAAAAAAACCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 17.00% 1.12% 0.25% NA
All Indica  2759 97.70% 1.40% 0.40% 0.43% NA
All Japonica  1512 48.20% 49.10% 2.71% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.60% 0.00% 0.43% NA
Indica III  913 97.80% 0.00% 1.10% 1.10% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 25.00% 70.40% 4.56% 0.00% NA
Tropical Japonica  504 90.90% 8.50% 0.60% 0.00% NA
Japonica Intermediate  241 32.80% 66.00% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131035257 T -> DEL N N silent_mutation Average:95.136; most accessible tissue: Zhenshan97 flower, score: 99.461 N N N N
vg0131035257 T -> C LOC_Os01g53970.1 upstream_gene_variant ; 3325.0bp to feature; MODIFIER silent_mutation Average:95.136; most accessible tissue: Zhenshan97 flower, score: 99.461 N N N N
vg0131035257 T -> C LOC_Os01g53970-LOC_Os01g53980 intergenic_region ; MODIFIER silent_mutation Average:95.136; most accessible tissue: Zhenshan97 flower, score: 99.461 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0131035257 T C -0.06 -0.04 -0.06 0.0 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131035257 1.18E-07 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 7.66E-07 3.00E-08 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 7.16E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 NA 6.22E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 3.25E-07 NA mr1092 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 NA 5.83E-07 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 3.09E-08 NA mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 8.44E-06 1.28E-09 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 6.29E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 1.28E-06 1.28E-06 mr1128 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 1.29E-06 NA mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 5.72E-07 9.88E-08 mr1148 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 1.48E-08 NA mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 1.29E-06 8.10E-09 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 8.87E-06 7.59E-08 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 1.63E-07 NA mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 4.54E-07 4.54E-07 mr1074_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 6.27E-09 NA mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 8.54E-08 1.46E-10 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 1.48E-06 NA mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 3.77E-06 3.35E-10 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 3.95E-06 NA mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 2.13E-06 6.72E-07 mr1128_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 NA 9.35E-06 mr1148_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 7.10E-08 NA mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 1.58E-06 2.95E-09 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 1.43E-08 NA mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 2.90E-07 2.18E-10 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 NA 3.09E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131035257 NA 8.09E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251