| Variant ID: vg0130588133 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 30588133 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, A: 0.09, others allele: 0.00, population size: 173. )
AAGTATTCTTAGGTAAATGAGATACATGCTATAACTATGAATCTAAATAATAGCATCTTTAGATTCGTAGTATTAAGATATGACTTGTCCACCCAAAAAA[A/T]
TTTATATTTTGAGATGGATGGAGTATTTATGATCGACGGCATGCATTCAGATGCCATATCATTCATCAGGCAGTCTTTGAAGATTTGTCGGTCTTTCAGA
TCTGAAAGACCGACAAATCTTCAAAGACTGCCTGATGAATGATATGGCATCTGAATGCATGCCGTCGATCATAAATACTCCATCCATCTCAAAATATAAA[T/A]
TTTTTTGGGTGGACAAGTCATATCTTAATACTACGAATCTAAAGATGCTATTATTTAGATTCATAGTTATAGCATGTATCTCATTTACCTAAGAATACTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 33.50% | 1.97% | 2.16% | NA |
| All Indica | 2759 | 85.50% | 8.00% | 3.12% | 3.30% | NA |
| All Japonica | 1512 | 20.00% | 80.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.20% | 3.70% | 0.74% | 3.35% | NA |
| Indica I | 595 | 93.10% | 6.20% | 0.67% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.10% | 11.90% | 6.46% | 6.46% | NA |
| Indica Intermediate | 786 | 83.60% | 9.40% | 2.93% | 4.07% | NA |
| Temperate Japonica | 767 | 17.30% | 82.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 14.10% | 85.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 40.70% | 59.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 90.60% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 60.00% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0130588133 | A -> T | LOC_Os01g53230.1 | upstream_gene_variant ; 2710.0bp to feature; MODIFIER | silent_mutation | Average:47.337; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0130588133 | A -> T | LOC_Os01g53240.1 | upstream_gene_variant ; 1726.0bp to feature; MODIFIER | silent_mutation | Average:47.337; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0130588133 | A -> T | LOC_Os01g53220.1 | downstream_gene_variant ; 4390.0bp to feature; MODIFIER | silent_mutation | Average:47.337; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0130588133 | A -> T | LOC_Os01g53230-LOC_Os01g53240 | intergenic_region ; MODIFIER | silent_mutation | Average:47.337; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0130588133 | A -> DEL | N | N | silent_mutation | Average:47.337; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0130588133 | NA | 2.10E-06 | mr1097 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130588133 | NA | 3.94E-15 | mr1553 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130588133 | NA | 3.31E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130588133 | NA | 1.80E-13 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |