Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129591345:

Variant ID: vg0129591345 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29591345
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTATTATTGTATTATATAGCTAGATAGCTCCATCACATCTGTTCTAGAAGCTAGAAACTCTTACATTAATCGAGAGAAATTTTGACCATTATATTATA[G/A]
TGGTCTAAATTGTAGCGATATGAACGATAAATAAAGACATACAGTTGTATACAACCCTAAATTAAGACATAAACCAATAGTTGTATACGTCAAATCCAAT

Reverse complement sequence

ATTGGATTTGACGTATACAACTATTGGTTTATGTCTTAATTTAGGGTTGTATACAACTGTATGTCTTTATTTATCGTTCATATCGCTACAATTTAGACCA[C/T]
TATAATATAATGGTCAAAATTTCTCTCGATTAATGTAAGAGTTTCTAGCTTCTAGAACAGATGTGATGGAGCTATCTAGCTATATAATACAATAATAGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	3.50%	2.03%	0.78%	NA
All Indica	2759	94.60%	1.20%	2.86%	1.34%	NA
All Japonica	1512	91.30%	8.00%	0.73%	0.00%	NA
Aus	269	97.00%	1.50%	1.49%	0.00%	NA
Indica I	595	91.30%	2.00%	6.72%	0.00%	NA
Indica II	465	95.50%	0.40%	3.87%	0.22%	NA
Indica III	913	95.40%	0.50%	0.22%	3.83%	NA
Indica Intermediate	786	95.50%	1.90%	2.42%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	74.20%	23.60%	2.18%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	6.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129591345	G -> A	LOC_Os01g51470.1	upstream_gene_variant ; 4940.0bp to feature; MODIFIER	silent_mutation	Average:31.018; most accessible tissue: Callus, score: 58.145	N	N	N	N
vg0129591345	G -> A	LOC_Os01g51490.1	upstream_gene_variant ; 1002.0bp to feature; MODIFIER	silent_mutation	Average:31.018; most accessible tissue: Callus, score: 58.145	N	N	N	N
vg0129591345	G -> A	LOC_Os01g51510.1	upstream_gene_variant ; 2382.0bp to feature; MODIFIER	silent_mutation	Average:31.018; most accessible tissue: Callus, score: 58.145	N	N	N	N
vg0129591345	G -> A	LOC_Os01g51480.1	downstream_gene_variant ; 3721.0bp to feature; MODIFIER	silent_mutation	Average:31.018; most accessible tissue: Callus, score: 58.145	N	N	N	N
vg0129591345	G -> A	LOC_Os01g51500.1	downstream_gene_variant ; 1370.0bp to feature; MODIFIER	silent_mutation	Average:31.018; most accessible tissue: Callus, score: 58.145	N	N	N	N
vg0129591345	G -> A	LOC_Os01g51490-LOC_Os01g51500	intergenic_region ; MODIFIER	silent_mutation	Average:31.018; most accessible tissue: Callus, score: 58.145	N	N	N	N
vg0129591345	G -> DEL	N	N	silent_mutation	Average:31.018; most accessible tissue: Callus, score: 58.145	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129591345	NA	5.76E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345	NA	4.41E-06	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345	5.64E-08	5.64E-08	mr1663	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345	NA	5.41E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345	3.12E-07	NA	mr1124_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345	NA	1.37E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251