Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129349785:

Variant ID: vg0129349785 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29349785
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGCACTTTGAACCACGCCATGCTATCAAGAGCCAGGCCCTCGCCGATTTTGTGGCAGAGTGGACCCCAGCTCCCGGGCCCGTCTCAGTCCCCGAGGC[T/C]
AGCTCGGGCCCCTCGCAGCTGCCTCACACGCCCACTGGGTGATGCAGTTCGACGGCTCCCTGTCTCTTCAGGGCGCCGGTGCGGGGGTCACGTTGACCTC

Reverse complement sequence

GAGGTCAACGTGACCCCCGCACCGGCGCCCTGAAGAGACAGGGAGCCGTCGAACTGCATCACCCAGTGGGCGTGTGAGGCAGCTGCGAGGGGCCCGAGCT[A/G]
GCCTCGGGGACTGAGACGGGCCCGGGAGCTGGGGTCCACTCTGCCACAAAATCGGCGAGGGCCTGGCTCTTGATAGCATGGCGTGGTTCAAAGTGCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.10%	20.80%	26.30%	11.81%	NA
All Indica	2759	57.50%	2.20%	36.97%	3.30%	NA
All Japonica	1512	17.70%	58.80%	4.17%	19.31%	NA
Aus	269	9.70%	3.70%	42.75%	43.87%	NA
Indica I	595	34.50%	2.20%	58.99%	4.37%	NA
Indica II	465	49.50%	1.70%	45.38%	3.44%	NA
Indica III	913	79.40%	2.50%	15.88%	2.19%	NA
Indica Intermediate	786	54.30%	2.20%	39.82%	3.69%	NA
Temperate Japonica	767	2.30%	92.00%	0.13%	5.48%	NA
Tropical Japonica	504	35.90%	14.70%	10.32%	39.09%	NA
Japonica Intermediate	241	28.60%	45.20%	4.15%	21.99%	NA
VI/Aromatic	96	35.40%	0.00%	18.75%	45.83%	NA
Intermediate	90	28.90%	26.70%	30.00%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129349785	T -> DEL	N	N	silent_mutation	Average:16.63; most accessible tissue: Callus, score: 29.634	N	N	N	N
vg0129349785	T -> C	LOC_Os01g51080.1	downstream_gene_variant ; 1561.0bp to feature; MODIFIER	silent_mutation	Average:16.63; most accessible tissue: Callus, score: 29.634	N	N	N	N
vg0129349785	T -> C	LOC_Os01g51100.1	downstream_gene_variant ; 2898.0bp to feature; MODIFIER	silent_mutation	Average:16.63; most accessible tissue: Callus, score: 29.634	N	N	N	N
vg0129349785	T -> C	LOC_Os01g51090.1	intron_variant ; MODIFIER	silent_mutation	Average:16.63; most accessible tissue: Callus, score: 29.634	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129349785	NA	2.64E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	3.78E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	6.61E-15	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	7.74E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	2.15E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	1.07E-15	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	5.65E-06	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	9.03E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	4.39E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	8.25E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	5.27E-26	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	1.56E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	3.67E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	8.27E-22	mr1682_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129349785	NA	2.44E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251