Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128562860:

Variant ID: vg0128562860 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28562860
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCGCCGGCTGCCCGGTTGCTCACGACAAGTCAAACACCATGTGTTAGGCTGTGTTTAGATTTAAAATTTGGATCCAAACTTCAAACTTCAGTTCTTTT[C/T]
CATCACATTAACCTGTCATGCACACATAACTTTTCAATCATATCATTTTCAATTTTAATCAAAATCCAAACTTTGCGCTGAAAGCCTTAGTACCGCTGTG

Reverse complement sequence

CACAGCGGTACTAAGGCTTTCAGCGCAAAGTTTGGATTTTGATTAAAATTGAAAATGATATGATTGAAAAGTTATGTGTGCATGACAGGTTAATGTGATG[G/A]
AAAAGAACTGAAGTTTGAAGTTTGGATCCAAATTTTAAATCTAAACACAGCCTAACACATGGTGTTTGACTTGTCGTGAGCAACCGGGCAGCCGGCGCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 33.40% 0.04% 0.00% NA
All Indica  2759 52.20% 47.80% 0.07% 0.00% NA
All Japonica  1512 93.20% 6.80% 0.00% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 54.50% 45.40% 0.17% 0.00% NA
Indica II  465 63.70% 36.10% 0.22% 0.00% NA
Indica III  913 42.60% 57.40% 0.00% 0.00% NA
Indica Intermediate  786 54.70% 45.30% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 81.20% 18.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128562860 C -> T LOC_Os01g49690.1 downstream_gene_variant ; 2161.0bp to feature; MODIFIER silent_mutation Average:93.772; most accessible tissue: Zhenshan97 flower, score: 98.346 N N N N
vg0128562860 C -> T LOC_Os01g49710.1 downstream_gene_variant ; 3765.0bp to feature; MODIFIER silent_mutation Average:93.772; most accessible tissue: Zhenshan97 flower, score: 98.346 N N N N
vg0128562860 C -> T LOC_Os01g49690-LOC_Os01g49710 intergenic_region ; MODIFIER silent_mutation Average:93.772; most accessible tissue: Zhenshan97 flower, score: 98.346 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128562860 C T -0.01 -0.01 0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128562860 NA 4.57E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128562860 NA 3.29E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 1.97E-06 mr1186 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 7.85E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 7.85E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 3.69E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 6.37E-06 mr1616 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 3.11E-06 mr1616 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 2.66E-06 mr1639 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 2.66E-06 mr1648 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 1.35E-09 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 7.22E-06 4.80E-11 mr1706 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 1.14E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 4.19E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 2.24E-06 mr1960 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 1.02E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 6.67E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 1.49E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 6.53E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 4.28E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 1.62E-06 mr1545_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 5.21E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 7.36E-06 mr1761_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 3.56E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 3.12E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 2.65E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128562860 NA 4.38E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251