Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128353459:

Variant ID: vg0128353459 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28353459
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTCTGATGTATAAATCTTTTATGTATTTTTTTAGTTAATTGAATCCATGCCTTTAAAAATTTACCAATTTAAAAAAATAACACTACTATTCGCGATAT[T/C]
GGGTGTATACCACTGGAAATTTGTAAAATTCGAACTGTGCCACTCCATCACGATTTCTATCAACACATCCGTCAGCTCCAACTCCGGCAACAGCCTACGT

Reverse complement sequence

ACGTAGGCTGTTGCCGGAGTTGGAGCTGACGGATGTGTTGATAGAAATCGTGATGGAGTGGCACAGTTCGAATTTTACAAATTTCCAGTGGTATACACCC[A/G]
ATATCGCGAATAGTAGTGTTATTTTTTTAAATTGGTAAATTTTTAAAGGCATGGATTCAATTAACTAAAAAAATACATAAAAGATTTATACATCAGACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	32.10%	0.02%	0.00%	NA
All Indica	2759	98.10%	1.90%	0.00%	0.00%	NA
All Japonica	1512	6.90%	93.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	18.10%	81.90%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	53.30%	45.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128353459	T -> C	LOC_Os01g49310.1	downstream_gene_variant ; 2409.0bp to feature; MODIFIER	silent_mutation	Average:73.873; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0128353459	T -> C	LOC_Os01g49320.1	downstream_gene_variant ; 1312.0bp to feature; MODIFIER	silent_mutation	Average:73.873; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0128353459	T -> C	LOC_Os01g49310.2	downstream_gene_variant ; 2425.0bp to feature; MODIFIER	silent_mutation	Average:73.873; most accessible tissue: Callus, score: 89.176	N	N	N	N
vg0128353459	T -> C	LOC_Os01g49310-LOC_Os01g49320	intergenic_region ; MODIFIER	silent_mutation	Average:73.873; most accessible tissue: Callus, score: 89.176	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128353459	NA	2.52E-11	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128353459	NA	1.75E-31	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	1.70E-27	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	6.95E-85	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	1.33E-36	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	3.45E-27	mr1423	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	5.12E-24	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	1.68E-55	mr1235_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	4.72E-42	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	5.36E-94	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	9.03E-28	mr1403_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	8.42E-31	mr1423_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	9.02E-46	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	8.12E-61	mr1599_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	1.25E-43	mr1805_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	5.15E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459	NA	7.29E-55	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251