Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128147955:

Variant ID: vg0128147955 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28147955
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTAAACTTTTGACTTATAAACTTTTGATCTAAAACTTTAGGTGTATAAACTTTAGATGTATAGAAATACTATATATAGAAAATATTTGAATTCAAATT[C/T]
AAATTTGAATCAGATATAATTCAAATTCAAATTTGAAATGGGTATATAAACTTTTAACTTATAAACTTTAGATGTATAGAAATACTATATATAAAAAAAT

Reverse complement sequence

ATTTTTTTATATATAGTATTTCTATACATCTAAAGTTTATAAGTTAAAAGTTTATATACCCATTTCAAATTTGAATTTGAATTATATCTGATTCAAATTT[G/A]
AATTTGAATTCAAATATTTTCTATATATAGTATTTCTATACATCTAAAGTTTATACACCTAAAGTTTTAGATCAAAAGTTTATAAGTCAAAAGTTTACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.30%	12.00%	4.70%	1.04%	NA
All Indica	2759	72.70%	20.20%	6.02%	1.12%	NA
All Japonica	1512	95.50%	0.10%	3.31%	1.06%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	65.90%	27.40%	5.88%	0.84%	NA
Indica II	465	45.20%	38.70%	13.33%	2.80%	NA
Indica III	913	95.60%	3.00%	1.42%	0.00%	NA
Indica Intermediate	786	67.60%	23.70%	7.12%	1.65%	NA
Temperate Japonica	767	93.50%	0.00%	4.82%	1.69%	NA
Tropical Japonica	504	98.80%	0.20%	0.60%	0.40%	NA
Japonica Intermediate	241	95.00%	0.40%	4.15%	0.41%	NA
VI/Aromatic	96	97.90%	0.00%	2.08%	0.00%	NA
Intermediate	90	85.60%	7.80%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128147955	C -> T	LOC_Os01g49000.1	downstream_gene_variant ; 4595.0bp to feature; MODIFIER	silent_mutation	Average:16.436; most accessible tissue: Callus, score: 21.752	N	N	N	N
vg0128147955	C -> T	LOC_Os01g49000-LOC_Os01g49010	intergenic_region ; MODIFIER	silent_mutation	Average:16.436; most accessible tissue: Callus, score: 21.752	N	N	N	N
vg0128147955	C -> DEL	N	N	silent_mutation	Average:16.436; most accessible tissue: Callus, score: 21.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128147955	NA	9.83E-06	mr1186	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147955	NA	3.11E-06	mr1186	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147955	NA	3.17E-07	mr1252	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147955	NA	2.35E-06	mr1376	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147955	NA	2.35E-06	mr1431	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147955	NA	4.76E-06	mr1550	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147955	NA	8.60E-07	mr1583	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147955	NA	1.87E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147955	NA	2.29E-06	mr1550_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251