Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128103219:

Variant ID: vg0128103219 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28103219
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTAGGTTGTGACGGTATCTGCATCTCTACGGGAGTATTTTCGTACGGGTCCCCGACAAGATCAGAATTTGGGGTCCAAAGCTTAAGCCCATTGTGCTG[T/C]
GCTAGCTGGAGTACGATTGTAAGTACAATGGAATGAAAGAAACACAAGATTGACGACAACCCTACTGTACCATGGATCAGTTATTACTTCAAACATTTTC

Reverse complement sequence

GAAAATGTTTGAAGTAATAACTGATCCATGGTACAGTAGGGTTGTCGTCAATCTTGTGTTTCTTTCATTCCATTGTACTTACAATCGTACTCCAGCTAGC[A/G]
CAGCACAATGGGCTTAAGCTTTGGACCCCAAATTCTGATCTTGTCGGGGACCCGTACGAAAATACTCCCGTAGAGATGCAGATACCGTCACAACCTACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 39.30% 0.00% 0.00% NA
All Indica  2759 97.40% 2.60% 0.00% 0.00% NA
All Japonica  1512 8.50% 91.50% 0.00% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 94.80% 5.20% 0.00% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 23.40% 76.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 37.80% 62.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128103219 T -> C LOC_Os01g48960.1 upstream_gene_variant ; 289.0bp to feature; MODIFIER silent_mutation Average:96.076; most accessible tissue: Callus, score: 98.564 N N N N
vg0128103219 T -> C LOC_Os01g48960-LOC_Os01g48970 intergenic_region ; MODIFIER silent_mutation Average:96.076; most accessible tissue: Callus, score: 98.564 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128103219 T C -0.02 -0.02 -0.02 -0.03 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128103219 NA 1.19E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 2.14E-20 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 7.03E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 7.58E-32 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 1.84E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 4.91E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 4.58E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 2.32E-31 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 1.52E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 1.05E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 1.58E-26 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 1.34E-09 mr1862 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 3.11E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 3.73E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 2.02E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 1.22E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 7.50E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 2.15E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 1.88E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 1.39E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 9.78E-45 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 7.42E-17 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128103219 NA 2.91E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251