Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128089631:

Variant ID: vg0128089631 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 28089631
Reference Allele: GA	Alternative Allele: AA,G
Primary Allele: AA	Secondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGCTAGCCATACGTTGCGGATAATTGTACTATGGCGTTGGCCAGGGCTTGGGCCGCCGTTTGTGTGGTGTCGTCATTTGTATGATATTTAAATAGTTAT[GA/AA,G]
AAAAATAAAAAAATTAACTAAATAGATTAATATGTGATAGATTTATTCTATAAATATGCAAGTTAAAAATTCAACTTCTTCAAGTTAAAATAAACAAATT

Reverse complement sequence

AATTTGTTTATTTTAACTTGAAGAAGTTGAATTTTTAACTTGCATATTTATAGAATAAATCTATCACATATTAATCTATTTAGTTAATTTTTTTATTTTT[TC/TT,C]
ATAACTATTTAAATATCATACAAATGACGACACCACACAAACGGCGGCCCAAGCCCTGGCCAACGCCATAGTACAATTATCCGCAACGTATGGCTAGCTC

Allele Frequencies:

Populations	Population Size	Frequency of AA(primary allele)	Frequency of GA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	31.50%	0.63%	7.22%	G: 0.06%
All Indica	2759	97.10%	1.30%	0.40%	1.20%	NA
All Japonica	1512	8.60%	90.90%	0.07%	0.46%	NA
Aus	269	5.60%	9.30%	3.72%	80.67%	G: 0.74%
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	96.80%	3.00%	0.22%	0.00%	NA
Indica III	913	97.80%	0.30%	0.55%	1.31%	NA
Indica Intermediate	786	94.40%	2.40%	0.51%	2.67%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	23.40%	76.20%	0.20%	0.20%	NA
Japonica Intermediate	241	3.30%	94.20%	0.00%	2.49%	NA
VI/Aromatic	96	3.10%	13.50%	7.29%	76.04%	NA
Intermediate	90	37.80%	47.80%	1.11%	12.22%	G: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128089631	GA -> G	LOC_Os01g48940.1	upstream_gene_variant ; 3223.0bp to feature; MODIFIER	silent_mutation	Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942	N	N	N	N
vg0128089631	GA -> G	LOC_Os01g48950.1	upstream_gene_variant ; 526.0bp to feature; MODIFIER	silent_mutation	Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942	N	N	N	N
vg0128089631	GA -> G	LOC_Os01g48960.1	downstream_gene_variant ; 1576.0bp to feature; MODIFIER	silent_mutation	Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942	N	N	N	N
vg0128089631	GA -> G	LOC_Os01g48950-LOC_Os01g48960	intergenic_region ; MODIFIER	silent_mutation	Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942	N	N	N	N
vg0128089631	GA -> AA	LOC_Os01g48940.1	upstream_gene_variant ; 3222.0bp to feature; MODIFIER	silent_mutation	Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942	N	N	N	N
vg0128089631	GA -> AA	LOC_Os01g48950.1	upstream_gene_variant ; 525.0bp to feature; MODIFIER	silent_mutation	Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942	N	N	N	N
vg0128089631	GA -> AA	LOC_Os01g48960.1	downstream_gene_variant ; 1577.0bp to feature; MODIFIER	silent_mutation	Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942	N	N	N	N
vg0128089631	GA -> AA	LOC_Os01g48950-LOC_Os01g48960	intergenic_region ; MODIFIER	silent_mutation	Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942	N	N	N	N
vg0128089631	GA -> DEL	N	N	silent_mutation	Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0128089631	GA	AA	0.04	0.03	0.02	0.02	0.02	0.01
vg0128089631	GA	G	-0.01	-0.01	0.08	-0.01	-0.03	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128089631	NA	6.51E-17	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	1.06E-14	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	6.40E-21	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	3.33E-30	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	6.08E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	7.16E-11	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	2.82E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	3.39E-49	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	4.50E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	3.06E-14	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	1.06E-26	mr1862	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	3.41E-08	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	3.64E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	2.19E-12	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	7.26E-38	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	9.30E-34	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	7.13E-25	mr1244_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	7.66E-07	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	1.07E-24	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	5.46E-25	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	3.36E-45	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	3.64E-17	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631	NA	1.22E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251