| Variant ID: vg0127890553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27890553 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAAATGCCATAGGAGATCCAAAACAATGACGACACCGAGGCACAGTATTTGATAACGGAGTTCAGCTGAGGCCTACATCTCCGGGGCACTGATTACAGG[T/C]
GCTCCTCCCCGATCCAGCATATTACAGCGTATCAGAGTTACAACGACTCACGGTCAGTCGTCGCCGGCAACCGCTCCCTCTCGCTATGCTATGTCGCCAT
ATGGCGACATAGCATAGCGAGAGGGAGCGGTTGCCGGCGACGACTGACCGTGAGTCGTTGTAACTCTGATACGCTGTAATATGCTGGATCGGGGAGGAGC[A/G]
CCTGTAATCAGTGCCCCGGAGATGTAGGCCTCAGCTGAACTCCGTTATCAAATACTGTGCCTCGGTGTCGTCATTGTTTTGGATCTCCTATGGCATTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.30% | 10.10% | 1.50% | 0.11% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 64.20% | 30.90% | 4.56% | 0.33% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 41.70% | 50.10% | 7.56% | 0.65% | NA |
| Tropical Japonica | 504 | 97.20% | 2.00% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.80% | 30.30% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127890553 | T -> DEL | N | N | silent_mutation | Average:54.412; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0127890553 | T -> C | LOC_Os01g48640.1 | downstream_gene_variant ; 4485.0bp to feature; MODIFIER | silent_mutation | Average:54.412; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0127890553 | T -> C | LOC_Os01g48650.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.412; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127890553 | NA | 3.46E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127890553 | NA | 6.42E-06 | mr1185_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127890553 | NA | 6.27E-06 | mr1892_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127890553 | NA | 9.87E-06 | mr1912_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127890553 | NA | 4.95E-06 | mr1912_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127890553 | 1.86E-06 | 1.85E-06 | mr1919_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |