RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0127642064:

Variant ID: vg0127642064 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 27642064
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAGAAGTCCCACCAAACCACCAGCAGCTTTACCATTGTACTCCTCTACAACTCGCCTGCTGCCTCCCTTTCTTATTGTCATTGAGATTTTAAAATCGTA[C/T]
ATGATTATCATTGATTTTTTTTTACTTTTTAGAAGTTACGAACCTTTAAAAATTGGACTTGTAGTTTTATTTTTTTTATAATTTTTAGAAGTCCCATCAA

Reverse complement sequence

TTGATGGGACTTCTAAAAATTATAAAAAAAATAAAACTACAAGTCCAATTTTTAAAGGTTCGTAACTTCTAAAAAGTAAAAAAAAATCAATGATAATCAT[G/A]
TACGATTTTAAAATCTCAATGACAATAAGAAAGGGAGGCAGCAGGCGAGTTGTAGAGGAGTACAATGGTAAAGCTGCTGGTGGTTTGGTGGGACTTCTAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	12.10%	0.02%	0.00%	NA
All Indica	2759	92.60%	7.30%	0.04%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	4.80%	95.20%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	85.50%	14.50%	0.00%	0.00%	NA
Indica Intermediate	786	92.20%	7.60%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0127642064	C -> T	LOC_Os01g48220-LOC_Os01g48230	intergenic_region ; MODIFIER	silent_mutation	Average:34.537; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0127642064	NA	1.03E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064	NA	2.90E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064	NA	5.17E-10	mr1126	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064	NA	8.92E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064	NA	4.16E-23	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064	NA	1.78E-12	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064	NA	1.57E-25	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064	NA	3.07E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064	NA	3.29E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064	NA	1.77E-06	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 28 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0127642064:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact