Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127430545:

Variant ID: vg0127430545 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 27430545
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

AGCAGTTGAGTGACCATATTAAGTGCTCAAATGTGAATTTCCCCAAAATTTAATATTGTCCAATATTTAATATATATCCTAGATTTTTATAATTTCCTAT[G/A]
TTTGGGATTTTGGTATTTATATGTTTTCACATATATTGGTTTATCTTTTTGGATTGGTTTTACCACCACATGGATTTCTATAATTTAGCATTTGTGATTC

Reverse complement sequence

GAATCACAAATGCTAAATTATAGAAATCCATGTGGTGGTAAAACCAATCCAAAAAGATAAACCAATATATGTGAAAACATATAAATACCAAAATCCCAAA[C/T]
ATAGGAAATTATAAAAATCTAGGATATATATTAAATATTGGACAATATTAAATTTTGGGGAAATTCACATTTGAGCACTTAATATGGTCACTCAACTGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	38.40%	5.69%	0.85%	NA
All Indica	2759	86.00%	3.90%	8.77%	1.34%	NA
All Japonica	1512	1.70%	97.40%	0.93%	0.00%	NA
Aus	269	27.90%	68.80%	2.60%	0.74%	NA
Indica I	595	80.20%	4.20%	14.62%	1.01%	NA
Indica II	465	77.80%	5.40%	14.41%	2.37%	NA
Indica III	913	95.20%	1.40%	1.64%	1.75%	NA
Indica Intermediate	786	84.60%	5.60%	9.29%	0.51%	NA
Temperate Japonica	767	0.30%	99.60%	0.13%	0.00%	NA
Tropical Japonica	504	3.20%	94.20%	2.58%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	37.80%	55.60%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0127430545	G -> A	LOC_Os01g47920.1	upstream_gene_variant ; 3806.0bp to feature; MODIFIER	silent_mutation	Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0127430545	G -> A	LOC_Os01g47930.1	upstream_gene_variant ; 1527.0bp to feature; MODIFIER	silent_mutation	Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0127430545	G -> A	LOC_Os01g47920-LOC_Os01g47930	intergenic_region ; MODIFIER	silent_mutation	Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg0127430545	G -> DEL	N	N	silent_mutation	Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0127430545	NA	1.32E-24	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545	NA	2.63E-14	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545	5.63E-06	3.10E-25	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545	NA	3.83E-25	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545	NA	1.44E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545	NA	1.53E-07	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545	NA	9.26E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545	1.13E-06	4.10E-27	mr1051_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545	NA	6.98E-26	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251