Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126776565:

Variant ID: vg0126776565 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 26776565
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, T: 0.19, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TAATTATAAGAGTTCAAGTAGGAATATAATTTATGAATTAAAAATATCGGAATGAAAGATATGCAATTTTCAAAAAAAAAAGTCAATCTAGAACACAACG[A/T]
TGACAAATGACAATAAAGAGGGAAGAAGCAATAAGCCTATAAAGGAGTAGAGTACTAGTGGTTGATGGGATATCTAAAAACTATAATCAAAACCCCAAAT

Reverse complement sequence

ATTTGGGGTTTTGATTATAGTTTTTAGATATCCCATCAACCACTAGTACTCTACTCCTTTATAGGCTTATTGCTTCTTCCCTCTTTATTGTCATTTGTCA[T/A]
CGTTGTGTTCTAGATTGACTTTTTTTTTTGAAAATTGCATATCTTTCATTCCGATATTTTTAATTCATAAATTATATTCCTACTTGAACTCTTATAATTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.00%	38.80%	0.25%	0.00%	NA
All Indica	2759	90.90%	8.80%	0.33%	0.00%	NA
All Japonica	1512	5.30%	94.70%	0.00%	0.00%	NA
Aus	269	82.50%	16.70%	0.74%	0.00%	NA
Indica I	595	81.70%	17.50%	0.84%	0.00%	NA
Indica II	465	96.10%	3.20%	0.65%	0.00%	NA
Indica III	913	92.00%	7.90%	0.11%	0.00%	NA
Indica Intermediate	786	93.50%	6.50%	0.00%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	13.90%	86.10%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	38.50%	61.50%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0126776565	A -> T	LOC_Os01g46920.1	upstream_gene_variant ; 2373.0bp to feature; MODIFIER	silent_mutation	Average:48.726; most accessible tissue: Zhenshan97 flag leaf, score: 89.624	N	N	N	N
vg0126776565	A -> T	LOC_Os01g46926.1	downstream_gene_variant ; 4474.0bp to feature; MODIFIER	silent_mutation	Average:48.726; most accessible tissue: Zhenshan97 flag leaf, score: 89.624	N	N	N	N
vg0126776565	A -> T	LOC_Os01g46926.2	downstream_gene_variant ; 4474.0bp to feature; MODIFIER	silent_mutation	Average:48.726; most accessible tissue: Zhenshan97 flag leaf, score: 89.624	N	N	N	N
vg0126776565	A -> T	LOC_Os01g46920-LOC_Os01g46926	intergenic_region ; MODIFIER	silent_mutation	Average:48.726; most accessible tissue: Zhenshan97 flag leaf, score: 89.624	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0126776565	NA	1.55E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126776565	NA	1.88E-06	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126776565	1.35E-07	1.35E-07	mr1335_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126776565	NA	3.55E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126776565	NA	1.11E-06	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126776565	NA	3.36E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251