Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126378704:

Variant ID: vg0126378704 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 26378704
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTCTAGAGTAGGCTAACTACTGTCACGCCCCGAACCAGCCCCGACCGGAACTAGCCCGTGACGCTCCAAATTAACCTGTTAATCGATACCAGTCCCAG[A/G]
AAACAGTGCTGGTACCACAGGGAGACAGAATACCACAGCAACAGAGGTCTCTTTATTATAGAGTAGAGGTACAGTCATGTTGGGCTGCGGACAGATTCCG

Reverse complement sequence

CGGAATCTGTCCGCAGCCCAACATGACTGTACCTCTACTCTATAATAAAGAGACCTCTGTTGCTGTGGTATTCTGTCTCCCTGTGGTACCAGCACTGTTT[T/C]
CTGGGACTGGTATCGATTAACAGGTTAATTTGGAGCGTCACGGGCTAGTTCCGGTCGGGGCTGGTTCGGGGCGTGACAGTAGTTAGCCTACTCTAGAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	21.90%	2.71%	0.51%	NA
All Indica	2759	95.30%	0.50%	3.30%	0.87%	NA
All Japonica	1512	32.80%	66.20%	0.99%	0.00%	NA
Aus	269	94.80%	0.40%	4.83%	0.00%	NA
Indica I	595	93.80%	1.00%	5.21%	0.00%	NA
Indica II	465	98.90%	0.60%	0.43%	0.00%	NA
Indica III	913	95.20%	0.20%	2.08%	2.52%	NA
Indica Intermediate	786	94.40%	0.50%	4.96%	0.13%	NA
Temperate Japonica	767	3.80%	94.90%	1.30%	0.00%	NA
Tropical Japonica	504	78.60%	20.80%	0.60%	0.00%	NA
Japonica Intermediate	241	29.50%	69.70%	0.83%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	3.12%	0.00%	NA
Intermediate	90	72.20%	21.10%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0126378704	A -> G	LOC_Os01g46350.1	upstream_gene_variant ; 4603.0bp to feature; MODIFIER	silent_mutation	Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488	N	N	N	N
vg0126378704	A -> G	LOC_Os01g46360.1	downstream_gene_variant ; 543.0bp to feature; MODIFIER	silent_mutation	Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488	N	N	N	N
vg0126378704	A -> G	LOC_Os01g46370.2	downstream_gene_variant ; 4891.0bp to feature; MODIFIER	silent_mutation	Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488	N	N	N	N
vg0126378704	A -> G	LOC_Os01g46360-LOC_Os01g46370	intergenic_region ; MODIFIER	silent_mutation	Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488	N	N	N	N
vg0126378704	A -> DEL	N	N	silent_mutation	Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0126378704	NA	1.33E-33	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0126378704	NA	1.02E-53	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0126378704	NA	7.87E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704	NA	6.41E-09	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704	NA	1.67E-08	mr1403	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704	NA	7.98E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704	NA	1.70E-22	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704	NA	1.52E-22	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704	NA	2.61E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251