Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125860145:

Variant ID: vg0125860145 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25860145
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, T: 0.19, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGTGCTTTTAAAATTATTTCATGAGCTCCAAAAATTCGCGGGAAATTTCAGAGAGTATTTTAGGGCACAAAGAATACTACAAAATATTCCCGGCCAAT[G/T]
ATTTTTAAAGGGAAAATTTTAATTCTCCCAATAATTCACTTGGATAAATTGCTTAACTTTTTATTTAATTTCTAGGAAATGCATTATTAAATGATTTTTA

Reverse complement sequence

TAAAAATCATTTAATAATGCATTTCCTAGAAATTAAATAAAAAGTTAAGCAATTTATCCAAGTGAATTATTGGGAGAATTAAAATTTTCCCTTTAAAAAT[C/A]
ATTGGCCGGGAATATTTTGTAGTATTCTTTGTGCCCTAAAATACTCTCTGAAATTTCCCGCGAATTTTTGGAGCTCATGAAATAATTTTAAAAGCACCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	31.20%	12.80%	23.40%	NA
All Indica	2759	49.00%	17.90%	17.69%	15.40%	NA
All Japonica	1512	4.30%	55.70%	1.06%	38.96%	NA
Aus	269	27.90%	28.60%	30.11%	13.38%	NA
Indica I	595	40.70%	3.70%	36.97%	18.66%	NA
Indica II	465	55.50%	9.90%	12.04%	22.58%	NA
Indica III	913	54.20%	30.80%	9.42%	5.59%	NA
Indica Intermediate	786	45.50%	18.30%	16.03%	20.10%	NA
Temperate Japonica	767	0.10%	95.70%	0.13%	4.04%	NA
Tropical Japonica	504	11.70%	5.00%	1.98%	81.35%	NA
Japonica Intermediate	241	2.10%	34.40%	2.07%	61.41%	NA
VI/Aromatic	96	21.90%	34.40%	9.38%	34.38%	NA
Intermediate	90	27.80%	34.40%	12.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125860145	G -> T	LOC_Os01g45550.1	upstream_gene_variant ; 3557.0bp to feature; MODIFIER	silent_mutation	Average:27.953; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0125860145	G -> T	LOC_Os01g45550.3	upstream_gene_variant ; 3557.0bp to feature; MODIFIER	silent_mutation	Average:27.953; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0125860145	G -> T	LOC_Os01g45550.2	upstream_gene_variant ; 3557.0bp to feature; MODIFIER	silent_mutation	Average:27.953; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0125860145	G -> T	LOC_Os01g45540.1	downstream_gene_variant ; 497.0bp to feature; MODIFIER	silent_mutation	Average:27.953; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0125860145	G -> T	LOC_Os01g45540-LOC_Os01g45550	intergenic_region ; MODIFIER	silent_mutation	Average:27.953; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0125860145	G -> DEL	N	N	silent_mutation	Average:27.953; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125860145	NA	1.38E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125860145	NA	6.00E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125860145	2.56E-07	2.56E-07	mr1703	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125860145	NA	2.37E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125860145	NA	3.03E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251