Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125172210:

Variant ID: vg0125172210 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25172210
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

ACGCTCCGGTGTACTTCGAGATAGTCGCCGAGGTTCCTCCAGATGCAGAGCAAGGCAAGTCATGCTTGTCACTTGAACATGTTGATCCTATATTGCAAAT[A/G]
CTCTATTGTTTTTCTTCAAATACTGCATCATTTTATAATGTTACTATGGGATGTTTACCTATTGTTACAGCCATGCTATTTTGGTACCCTGCTCCTTTGT

Reverse complement sequence

ACAAAGGAGCAGGGTACCAAAATAGCATGGCTGTAACAATAGGTAAACATCCCATAGTAACATTATAAAATGATGCAGTATTTGAAGAAAAACAATAGAG[T/C]
ATTTGCAATATAGGATCAACATGTTCAAGTGACAAGCATGACTTGCCTTGCTCTGCATCTGGAGGAACCTCGGCGACTATCTCGAAGTACACCGGAGCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.30%	26.60%	0.30%	3.72%	NA
All Indica	2759	98.20%	1.60%	0.14%	0.00%	NA
All Japonica	1512	16.30%	72.20%	0.33%	11.18%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	99.20%	0.50%	0.34%	0.00%	NA
Indica II	465	98.70%	1.10%	0.22%	0.00%	NA
Indica III	913	96.80%	3.10%	0.11%	0.00%	NA
Indica Intermediate	786	98.90%	1.10%	0.00%	0.00%	NA
Temperate Japonica	767	0.90%	98.20%	0.00%	0.91%	NA
Tropical Japonica	504	39.30%	35.50%	0.99%	24.21%	NA
Japonica Intermediate	241	17.40%	66.00%	0.00%	16.60%	NA
VI/Aromatic	96	9.40%	85.40%	0.00%	5.21%	NA
Intermediate	90	53.30%	38.90%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125172210	A -> G	LOC_Os01g43930.1	upstream_gene_variant ; 1485.0bp to feature; MODIFIER	silent_mutation	Average:13.71; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0125172210	A -> G	LOC_Os01g43920.1	downstream_gene_variant ; 1771.0bp to feature; MODIFIER	silent_mutation	Average:13.71; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0125172210	A -> G	LOC_Os01g43920-LOC_Os01g43930	intergenic_region ; MODIFIER	silent_mutation	Average:13.71; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0125172210	A -> DEL	N	N	silent_mutation	Average:13.71; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125172210	NA	4.31E-08	mr1946	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125172210	1.32E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125172210	6.72E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251