Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125115772:

Variant ID: vg0125115772 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25115772
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTAATATAAGTGATTTTGAACGGATGTGACACTTTTTAGTCCAACAAATCTTTTTCTGTTTAGATTTGTTGCAGTAGTAAGTCATATCCACCTAAAATC[C/T]
CTTATATTTTGAGGCAGGGGAATATATATTACTTCTCTCAAATCAGTCCAACGACATTTCCAATACGGAGAAGTCCTACCACATGGTATGTAAAGGTATA

Reverse complement sequence

TATACCTTTACATACCATGTGGTAGGACTTCTCCGTATTGGAAATGTCGTTGGACTGATTTGAGAGAAGTAATATATATTCCCCTGCCTCAAAATATAAG[G/A]
GATTTTAGGTGGATATGACTTACTACTGCAACAAATCTAAACAGAAAAAGATTTGTTGGACTAAAAAGTGTCACATCCGTTCAAAATCACTTATATTAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.50%	0.30%	0.17%	24.04%	NA
All Indica	2759	58.70%	0.50%	0.25%	40.52%	NA
All Japonica	1512	99.50%	0.00%	0.00%	0.46%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	67.20%	0.00%	0.17%	32.61%	NA
Indica II	465	50.30%	0.60%	0.22%	48.82%	NA
Indica III	913	57.50%	0.90%	0.11%	41.51%	NA
Indica Intermediate	786	58.50%	0.50%	0.51%	40.46%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	87.80%	1.10%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125115772	C -> T	LOC_Os01g43830.1	upstream_gene_variant ; 3724.0bp to feature; MODIFIER	silent_mutation	Average:79.788; most accessible tissue: Zhenshan97 young leaf, score: 97.572	N	N	N	N
vg0125115772	C -> T	LOC_Os01g43851.1	upstream_gene_variant ; 3962.0bp to feature; MODIFIER	silent_mutation	Average:79.788; most accessible tissue: Zhenshan97 young leaf, score: 97.572	N	N	N	N
vg0125115772	C -> T	LOC_Os01g43844.1	intron_variant ; MODIFIER	silent_mutation	Average:79.788; most accessible tissue: Zhenshan97 young leaf, score: 97.572	N	N	N	N
vg0125115772	C -> DEL	N	N	silent_mutation	Average:79.788; most accessible tissue: Zhenshan97 young leaf, score: 97.572	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0125115772	C	T	-0.01	0.0	-0.02	-0.01	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125115772	NA	6.06E-06	mr1106	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	NA	7.18E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	NA	7.10E-06	mr1418	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	7.07E-06	7.07E-06	mr1420	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	NA	2.86E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	3.88E-06	3.88E-06	mr1748	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	NA	1.13E-06	mr1763	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	2.97E-06	2.72E-08	mr1811	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	1.87E-06	1.87E-06	mr1811	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	NA	1.47E-06	mr1838	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	NA	2.52E-06	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772	NA	3.35E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251