Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124666730:

Variant ID: vg0124666730 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24666730
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAATCTCCGCAGGAATATAGCTGGAGAGGAGGTTGTGAGCCAGGAGCGCCGCGAGCTTCTGCAGCGTCGTGATGGCGACCGGGATCTGGCCGGCAAGCT[G/A]
GTTGTAGGGTAGCGACAACTCGGATGGGAGGTAGCTCGTGAGTGAGAAGTTGGCGAGCTCCACGTCGCCGACCCTGCCACCGCCGCCGTCGTCGACGCAG

Reverse complement sequence

CTGCGTCGACGACGGCGGCGGTGGCAGGGTCGGCGACGTGGAGCTCGCCAACTTCTCACTCACGAGCTACCTCCCATCCGAGTTGTCGCTACCCTACAAC[C/T]
AGCTTGCCGGCCAGATCCCGGTCGCCATCACGACGCTGCAGAAGCTCGCGGCGCTCCTGGCTCACAACCTCCTCTCCAGCTATATTCCTGCGGAGATTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.30%	0.02%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	83.20%	16.80%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	56.00%	44.00%	0.00%	0.00%	NA
Japonica Intermediate	241	87.60%	12.40%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124666730	G -> A	LOC_Os01g43180-LOC_Os01g43200	intergenic_region ; MODIFIER	silent_mutation	Average:71.065; most accessible tissue: Zhenshan97 young leaf, score: 88.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124666730	3.82E-07	1.96E-08	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	NA	1.01E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	NA	1.96E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	NA	4.09E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	1.18E-06	1.32E-07	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	NA	7.17E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	2.71E-06	2.71E-06	mr1436	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	NA	3.77E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	NA	2.43E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	NA	2.57E-06	mr1126_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	NA	2.68E-07	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730	NA	2.79E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251