Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124590858:

Variant ID: vg0124590858 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24590858
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

AGTAAATGAGACAATAGACAAGGAGTTTTTTTTTCACCCGAGGTTCGGATCGGTTTCCTACTCCCCGTTGAGACGAGCCCAACTTCACCGCTCAAAACCA[C/T]
GAAGCCACCGCAAGCCCCCTTCATCAAGGGGTGGGCAAGATGGGAGCTAGCCCACGAAGTGGACTACCCAAGCCTCGATCACTAGGAGTAGTTCTTCATT

Reverse complement sequence

AATGAAGAACTACTCCTAGTGATCGAGGCTTGGGTAGTCCACTTCGTGGGCTAGCTCCCATCTTGCCCACCCCTTGATGAAGGGGGCTTGCGGTGGCTTC[G/A]
TGGTTTTGAGCGGTGAAGTTGGGCTCGTCTCAACGGGGAGTAGGAAACCGATCCGAACCTCGGGTGAAAAAAAAACTCCTTGTCTATTGTCTCATTTACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	33.20%	1.29%	4.87%	NA
All Indica	2759	90.70%	6.60%	0.58%	2.14%	NA
All Japonica	1512	16.90%	82.80%	0.20%	0.07%	NA
Aus	269	17.80%	8.60%	11.90%	61.71%	NA
Indica I	595	99.20%	0.30%	0.34%	0.17%	NA
Indica II	465	97.60%	1.70%	0.22%	0.43%	NA
Indica III	913	80.20%	15.00%	0.66%	4.16%	NA
Indica Intermediate	786	92.50%	4.30%	0.89%	2.29%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	43.70%	56.30%	0.00%	0.00%	NA
Japonica Intermediate	241	11.20%	87.10%	1.24%	0.41%	NA
VI/Aromatic	96	10.40%	79.20%	7.29%	3.12%	NA
Intermediate	90	52.20%	43.30%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124590858	C -> T	LOC_Os01g43100.1	downstream_gene_variant ; 1435.0bp to feature; MODIFIER	silent_mutation	Average:48.622; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0124590858	C -> T	LOC_Os01g43110.1	downstream_gene_variant ; 1654.0bp to feature; MODIFIER	silent_mutation	Average:48.622; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0124590858	C -> T	LOC_Os01g43100-LOC_Os01g43110	intergenic_region ; MODIFIER	silent_mutation	Average:48.622; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0124590858	C -> DEL	N	N	silent_mutation	Average:48.622; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124590858	2.31E-06	9.88E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124590858	NA	6.25E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124590858	3.28E-06	6.57E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124590858	2.12E-06	NA	mr1070_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124590858	6.23E-07	6.23E-07	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124590858	2.08E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124590858	4.78E-06	1.28E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124590858	1.37E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124590858	3.11E-07	NA	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251