Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124420361:

Variant ID: vg0124420361 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24420361
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CTGAACAACACAAGCGGCATTATCTTCATAGATAATGGTAGGTGATTCCAATGAACCAATACCACAAGATGTTAATATGTGGTTAACCATTCTGCGAAGC[T/C]
ATATACATTCACGTGATGCCTCATATAATGCAATTATTTCAGAATGATTTGTGGAAGTGGCTACCAGAGTCTGTTTAGAAGACTTCCATGAAATAGCAGT

Reverse complement sequence

ACTGCTATTTCATGGAAGTCTTCTAAACAGACTCTGGTAGCCACTTCCACAAATCATTCTGAAATAATTGCATTATATGAGGCATCACGTGAATGTATAT[A/G]
GCTTCGCAGAATGGTTAACCACATATTAACATCTTGTGGTATTGGTTCATTGGAATCACCTACCATTATCTATGAAGATAATGCCGCTTGTGTTGTTCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	25.10%	3.07%	1.10%	NA
All Indica	2759	95.40%	1.10%	2.36%	1.20%	NA
All Japonica	1512	25.50%	70.20%	4.03%	0.33%	NA
Aus	269	97.40%	1.50%	1.12%	0.00%	NA
Indica I	595	94.30%	1.00%	2.69%	2.02%	NA
Indica II	465	94.40%	0.60%	3.01%	1.94%	NA
Indica III	913	96.60%	1.00%	1.75%	0.66%	NA
Indica Intermediate	786	95.30%	1.50%	2.42%	0.76%	NA
Temperate Japonica	767	1.30%	97.70%	1.04%	0.00%	NA
Tropical Japonica	504	54.60%	36.30%	8.53%	0.60%	NA
Japonica Intermediate	241	41.50%	53.50%	4.15%	0.83%	NA
VI/Aromatic	96	14.60%	59.40%	13.54%	12.50%	NA
Intermediate	90	54.40%	40.00%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124420361	T -> DEL	N	N	silent_mutation	Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661	N	N	N	N
vg0124420361	T -> C	LOC_Os01g42909.1	upstream_gene_variant ; 3513.0bp to feature; MODIFIER	silent_mutation	Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661	N	N	N	N
vg0124420361	T -> C	LOC_Os01g42920.1	downstream_gene_variant ; 122.0bp to feature; MODIFIER	silent_mutation	Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661	N	N	N	N
vg0124420361	T -> C	LOC_Os01g42934.1	downstream_gene_variant ; 3851.0bp to feature; MODIFIER	silent_mutation	Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661	N	N	N	N
vg0124420361	T -> C	LOC_Os01g42909-LOC_Os01g42920	intergenic_region ; MODIFIER	silent_mutation	Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124420361	NA	5.62E-06	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361	NA	8.42E-07	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361	NA	9.19E-09	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361	NA	1.22E-20	mr1657_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361	NA	1.70E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361	5.11E-06	5.11E-06	mr1832_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361	NA	5.96E-06	mr1833_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361	NA	6.41E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251