RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0124291514:

Variant ID: vg0124291514 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24291514
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.21, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTTGTTGGTTTCAATCGAGTTATGATTTTGTAATTCATAGTAGTTTGAACTGCAACATCTATAATAATTAGTTGTAACTTCTTTGAAGTAAAGACCGG[A/G]
ATGGATTCTATTGGTGAATTACAAAGCATGATCCCCAATATCTGCTGCTCGGGACGCCCATCAACACGCTATCAAGATTGGATGGCCTACATCGACATGT

Reverse complement sequence

ACATGTCGATGTAGGCCATCCAATCTTGATAGCGTGTTGATGGGCGTCCCGAGCAGCAGATATTGGGGATCATGCTTTGTAATTCACCAATAGAATCCAT[T/C]
CCGGTCTTTACTTCAAAGAAGTTACAACTAATTATTATAGATGTTGCAGTTCAAACTACTATGAATTACAAAATCATAACTCGATTGAAACCAACAAAAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	18.30%	0.02%	0.00%	NA
All Indica	2759	89.10%	10.90%	0.04%	0.00%	NA
All Japonica	1512	81.90%	18.10%	0.00%	0.00%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	89.20%	10.80%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	86.70%	13.30%	0.00%	0.00%	NA
Indica Intermediate	786	85.60%	14.20%	0.13%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	53.00%	47.00%	0.00%	0.00%	NA
Japonica Intermediate	241	86.70%	13.30%	0.00%	0.00%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124291514	A -> G	LOC_Os01g42710.1	upstream_gene_variant ; 1023.0bp to feature; MODIFIER	silent_mutation	Average:59.4; most accessible tissue: Callus, score: 74.789	N	N	N	N
vg0124291514	A -> G	LOC_Os01g42700-LOC_Os01g42710	intergenic_region ; MODIFIER	silent_mutation	Average:59.4; most accessible tissue: Callus, score: 74.789	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124291514	NA	7.01E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124291514	NA	2.22E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124291514	NA	6.00E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124291514	NA	2.42E-06	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124291514	NA	1.67E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124291514	NA	4.35E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124291514	NA	3.15E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124291514	NA	7.82E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124291514	NA	2.98E-06	mr1339	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124291514	NA	2.08E-09	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 48 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0124291514:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact