Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124234030:

Variant ID: vg0124234030 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24234030
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.24, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCTAGTAATTAAAAGCGTCGATTAATCAATGCCCACACTAAAATTCTAACAAAAACGGATCTGTATATATATAATTATGGATAAGTGCACCATACTCC[T/C]
TTCGTCCTATTTTCATCATCACCTAAGCAAATAGCGTAGAGACCAAGGACAACTAAACCTTTATCATTCTATAATTAATTCTCATCGATTAAGGTAATAT

Reverse complement sequence

ATATTACCTTAATCGATGAGAATTAATTATAGAATGATAAAGGTTTAGTTGTCCTTGGTCTCTACGCTATTTGCTTAGGTGATGATGAAAATAGGACGAA[A/G]
GGAGTATGGTGCACTTATCCATAATTATATATATACAGATCCGTTTTTGTTAGAATTTTAGTGTGGGCATTGATTAATCGACGCTTTTAATTACTAGGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	15.70%	0.04%	0.00%	NA
All Indica	2759	87.40%	12.50%	0.07%	0.00%	NA
All Japonica	1512	92.70%	7.30%	0.00%	0.00%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	89.90%	9.90%	0.17%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	84.40%	15.60%	0.00%	0.00%	NA
Indica Intermediate	786	83.60%	16.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	82.90%	17.10%	0.00%	0.00%	NA
Japonica Intermediate	241	92.10%	7.90%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124234030	T -> C	LOC_Os01g42610.1	upstream_gene_variant ; 599.0bp to feature; MODIFIER	silent_mutation	Average:60.217; most accessible tissue: Callus, score: 76.336	N	N	N	N
vg0124234030	T -> C	LOC_Os01g42600.1	downstream_gene_variant ; 3877.0bp to feature; MODIFIER	silent_mutation	Average:60.217; most accessible tissue: Callus, score: 76.336	N	N	N	N
vg0124234030	T -> C	LOC_Os01g42600-LOC_Os01g42610	intergenic_region ; MODIFIER	silent_mutation	Average:60.217; most accessible tissue: Callus, score: 76.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124234030	NA	6.20E-06	mr1400	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030	NA	6.70E-07	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030	NA	1.81E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030	NA	1.57E-07	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030	NA	6.08E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030	NA	7.18E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030	NA	3.19E-11	mr1792_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030	NA	6.45E-17	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030	NA	4.16E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251