Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124225721:

Variant ID: vg0124225721 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24225721
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAAAAAAATAAATTATAGATTCTGCCAGGAAACTGCGAGATGAATTTATTAAGCCTAATTAATCCGCTATTAGCAAATGTTCACTGTAGCACCACATT[G/A]
TCAAATCATGGTGCAATTTAGGCTTAAAAAATTTGTCACGCAATTTGCACGCAATATGTGTAATTGATTTTTTTTCATGCATTTAATACTCAATGCATGT

Reverse complement sequence

ACATGCATTGAGTATTAAATGCATGAAAAAAAATCAATTACACATATTGCGTGCAAATTGCGTGACAAATTTTTTAAGCCTAAATTGCACCATGATTTGA[C/T]
AATGTGGTGCTACAGTGAACATTTGCTAATAGCGGATTAATTAGGCTTAATAAATTCATCTCGCAGTTTCCTGGCAGAATCTATAATTTATTTTTTTATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 4.10% 0.00% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 88.00% 12.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 68.80% 31.20% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124225721 G -> A LOC_Os01g42600.1 upstream_gene_variant ; 4181.0bp to feature; MODIFIER silent_mutation Average:42.798; most accessible tissue: Callus, score: 78.984 N N N N
vg0124225721 G -> A LOC_Os01g42590-LOC_Os01g42600 intergenic_region ; MODIFIER silent_mutation Average:42.798; most accessible tissue: Callus, score: 78.984 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124225721 7.31E-06 2.66E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 NA 2.54E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 4.83E-06 1.13E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 5.36E-06 NA mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 6.92E-09 6.92E-09 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 NA 2.63E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 3.60E-06 2.45E-09 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 6.72E-07 2.58E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 NA 9.21E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 1.85E-07 1.85E-07 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 4.84E-06 3.44E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124225721 3.49E-06 1.31E-08 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251