RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0124176064:

Variant ID: vg0124176064 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24176064
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGCTCCTTAATTCCCAAATCATGGCTTTGTTCCCGGGTAAAAAGCACCATTCCAGTAGGTAAAAAATATTCTAAACTCTTAAGGGACATTCACTCCTT[G/A]
TTTCACTCCTTGTTTGTACGTCATCTAAATGATTATAATGAAACTTTAAAAAAATCAACAAAAGATATTAATATGTGATAAATCACTCTAGAAACATACA

Reverse complement sequence

TGTATGTTTCTAGAGTGATTTATCACATATTAATATCTTTTGTTGATTTTTTTAAAGTTTCATTATAATCATTTAGATGACGTACAAACAAGGAGTGAAA[C/T]
AAGGAGTGAATGTCCCTTAAGAGTTTAGAATATTTTTTACCTACTGGAATGGTGCTTTTTACCCGGGAACAAAGCCATGATTTGGGAATTAAGGAGCCGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.10%	1.50%	0.02%	0.36%	NA
All Indica	2759	99.50%	0.00%	0.00%	0.51%	NA
All Japonica	1512	95.20%	4.60%	0.07%	0.20%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.00%	0.00%	0.50%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.50%	0.00%	0.00%	0.55%	NA
Indica Intermediate	786	99.10%	0.10%	0.00%	0.76%	NA
Temperate Japonica	767	91.10%	8.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.20%	0.60%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124176064	G -> A	LOC_Os01g42510.1	upstream_gene_variant ; 4623.0bp to feature; MODIFIER	silent_mutation	Average:57.784; most accessible tissue: Callus, score: 76.703	N	N	N	N
vg0124176064	G -> A	LOC_Os01g42510.2	upstream_gene_variant ; 4623.0bp to feature; MODIFIER	silent_mutation	Average:57.784; most accessible tissue: Callus, score: 76.703	N	N	N	N
vg0124176064	G -> A	LOC_Os01g42510-LOC_Os01g42520	intergenic_region ; MODIFIER	silent_mutation	Average:57.784; most accessible tissue: Callus, score: 76.703	N	N	N	N
vg0124176064	G -> DEL	N	N	silent_mutation	Average:57.784; most accessible tissue: Callus, score: 76.703	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124176064	8.22E-07	8.22E-07	mr1067	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064	5.69E-08	1.57E-07	mr1069	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064	3.66E-06	NA	mr1075	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064	2.17E-08	2.61E-08	mr1124	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064	7.24E-06	NA	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064	4.14E-06	4.14E-06	mr1200	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064	NA	2.49E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064	2.47E-07	2.47E-07	mr1795	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064	4.17E-08	4.17E-08	mr1855	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064	1.18E-07	1.18E-07	mr1861	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 19 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0124176064:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact