| Variant ID: vg0124141412 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24141412 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.02, others allele: 0.00, population size: 272. )
AAGGTTCAACCAATTTCTAAGAAACAAGCCATAATCAAAATGTTCTGGTTCTACAATTTTCCTACTGATAGCCGTGTTTACTTTTGTGTGCTTACACCCT[T/G]
TTCTGCTATTTAACAGGACAGAAGCAAATGGTTCAAGATTGTGAGTAATCATTTTTCCTACATTGTCTCTTCTCTCTTGCGTATATACTATGATTGTACA
TGTACAATCATAGTATATACGCAAGAGAGAAGAGACAATGTAGGAAAAATGATTACTCACAATCTTGAACCATTTGCTTCTGTCCTGTTAAATAGCAGAA[A/C]
AGGGTGTAAGCACACAAAAGTAAACACGGCTATCAGTAGGAAAATTGTAGAACCAGAACATTTTGATTATGGCTTGTTTCTTAGAAATTGGTTGAACCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.60% | 21.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 66.40% | 33.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.80% | 25.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 62.40% | 37.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 66.30% | 33.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.00% | 9.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124141412 | T -> G | LOC_Os01g42470.1 | upstream_gene_variant ; 4431.0bp to feature; MODIFIER | silent_mutation | Average:42.287; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0124141412 | T -> G | LOC_Os01g42470.2 | upstream_gene_variant ; 4431.0bp to feature; MODIFIER | silent_mutation | Average:42.287; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0124141412 | T -> G | LOC_Os01g42460.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.287; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124141412 | 5.70E-06 | 5.70E-06 | mr1065 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124141412 | 7.82E-09 | 7.82E-09 | mr1067 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124141412 | 4.97E-07 | 9.96E-07 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124141412 | 2.89E-06 | NA | mr1075 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124141412 | 5.46E-07 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124141412 | 7.20E-06 | NA | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124141412 | 2.72E-07 | 1.95E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124141412 | 3.97E-06 | 1.72E-06 | mr1150 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124141412 | 1.23E-07 | NA | mr1200 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124141412 | 5.22E-07 | 5.23E-07 | mr1200 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/