Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124060154:

Variant ID: vg0124060154 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24060154
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

GGGCGCTGACGTCAGCATGACGTCAGCGCCCAATTTACATGCAAAACTACTTTAAATTGATTTTTCTCTTAAATTACTTTCCAAATCATGATCCGATTAC[G/A]
CCATTAAATTCGTTGCAATTAAATCTTCAAAACAAGACCATACATTGATATATTTCGATGAAAAAAAATTTAACTTATTATTGAATTATTTTTAAATGTT

Reverse complement sequence

AACATTTAAAAATAATTCAATAATAAGTTAAATTTTTTTTCATCGAAATATATCAATGTATGGTCTTGTTTTGAAGATTTAATTGCAACGAATTTAATGG[C/T]
GTAATCGGATCATGATTTGGAAAGTAATTTAAGAGAAAAATCAATTTAAAGTAGTTTTGCATGTAAATTGGGCGCTGACGTCATGCTGACGTCAGCGCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.10%	26.90%	1.08%	43.97%	NA
All Indica	2759	0.90%	24.20%	1.74%	73.18%	NA
All Japonica	1512	78.00%	21.10%	0.13%	0.79%	NA
Aus	269	1.90%	92.60%	0.00%	5.58%	NA
Indica I	595	0.70%	11.60%	1.18%	86.55%	NA
Indica II	465	0.20%	8.20%	3.87%	87.74%	NA
Indica III	913	0.80%	41.50%	0.55%	57.17%	NA
Indica Intermediate	786	1.50%	23.20%	2.29%	73.03%	NA
Temperate Japonica	767	98.00%	1.20%	0.26%	0.52%	NA
Tropical Japonica	504	50.20%	48.80%	0.00%	0.99%	NA
Japonica Intermediate	241	72.20%	26.60%	0.00%	1.24%	NA
VI/Aromatic	96	87.50%	10.40%	0.00%	2.08%	NA
Intermediate	90	37.80%	27.80%	1.11%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124060154	G -> A	LOC_Os01g42350.1	upstream_gene_variant ; 4236.0bp to feature; MODIFIER	silent_mutation	Average:30.234; most accessible tissue: Callus, score: 78.495	N	N	N	N
vg0124060154	G -> A	LOC_Os01g42360.1	downstream_gene_variant ; 1108.0bp to feature; MODIFIER	silent_mutation	Average:30.234; most accessible tissue: Callus, score: 78.495	N	N	N	N
vg0124060154	G -> A	LOC_Os01g42350-LOC_Os01g42360	intergenic_region ; MODIFIER	silent_mutation	Average:30.234; most accessible tissue: Callus, score: 78.495	N	N	N	N
vg0124060154	G -> DEL	N	N	silent_mutation	Average:30.234; most accessible tissue: Callus, score: 78.495	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124060154	3.57E-07	NA	mr1090	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154	4.64E-06	NA	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154	NA	4.23E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154	NA	3.16E-06	mr1920	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154	NA	5.92E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154	NA	1.95E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154	NA	2.83E-08	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251