Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123784118:

Variant ID: vg0123784118 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23784118
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.36, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAGGATGAAGAGAGAGAGAGAGGAGGGGAAAGAGATAGAGGGCGCTGACGTGGCATCCTGACACGTGGGGCTCACGTGGGTCCCATGCTGACTCAGCC[A/G]
TCACATCGGATAAATGAGTGAACGGTTTTGTAAGTTGATAGATGTTATATATCTGATTTTGTGGTTGGGGGATGATTTTGTAATTCGATGACAGGTTGAG

Reverse complement sequence

CTCAACCTGTCATCGAATTACAAAATCATCCCCCAACCACAAAATCAGATATATAACATCTATCAACTTACAAAACCGTTCACTCATTTATCCGATGTGA[T/C]
GGCTGAGTCAGCATGGGACCCACGTGAGCCCCACGTGTCAGGATGCCACGTCAGCGCCCTCTATCTCTTTCCCCTCCTCTCTCTCTCTCTTCATCCTCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 25.20% 1.14% 11.76% NA
All Indica  2759 91.40% 2.30% 0.58% 5.65% NA
All Japonica  1512 16.00% 71.90% 0.66% 11.44% NA
Aus  269 10.00% 0.70% 9.67% 79.55% NA
Indica I  595 97.50% 2.40% 0.00% 0.17% NA
Indica II  465 95.10% 2.60% 0.00% 2.37% NA
Indica III  913 89.70% 0.20% 0.88% 9.20% NA
Indica Intermediate  786 86.80% 4.60% 1.02% 7.63% NA
Temperate Japonica  767 1.20% 92.80% 0.26% 5.74% NA
Tropical Japonica  504 28.00% 50.60% 1.19% 20.24% NA
Japonica Intermediate  241 38.20% 49.80% 0.83% 11.20% NA
VI/Aromatic  96 86.50% 6.20% 1.04% 6.25% NA
Intermediate  90 57.80% 33.30% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123784118 A -> G LOC_Os01g41950.1 5_prime_UTR_variant ; 714.0bp to feature; MODIFIER silent_mutation Average:99.398; most accessible tissue: Zhenshan97 flower, score: 99.844 N N N N
vg0123784118 A -> G LOC_Os01g41960.1 upstream_gene_variant ; 3842.0bp to feature; MODIFIER silent_mutation Average:99.398; most accessible tissue: Zhenshan97 flower, score: 99.844 N N N N
vg0123784118 A -> G LOC_Os01g41930.1 downstream_gene_variant ; 4371.0bp to feature; MODIFIER silent_mutation Average:99.398; most accessible tissue: Zhenshan97 flower, score: 99.844 N N N N
vg0123784118 A -> DEL N N silent_mutation Average:99.398; most accessible tissue: Zhenshan97 flower, score: 99.844 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123784118 A G 0.02 0.03 0.03 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123784118 4.24E-07 1.36E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123784118 NA 1.42E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123784118 NA 7.19E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123784118 8.67E-07 3.55E-13 mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251